Incidental Mutation 'R4207:Mthfsd'
ID 318971
Institutional Source Beutler Lab
Gene Symbol Mthfsd
Ensembl Gene ENSMUSG00000031816
Gene Name methenyltetrahydrofolate synthetase domain containing
Synonyms
MMRRC Submission 041036-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.096) question?
Stock # R4207 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 121818367-121835131 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 121832365 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 133 (V133A)
Ref Sequence ENSEMBL: ENSMUSP00000119673 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047282] [ENSMUST00000116415] [ENSMUST00000126431] [ENSMUST00000127664] [ENSMUST00000128052] [ENSMUST00000133037] [ENSMUST00000134758] [ENSMUST00000139782] [ENSMUST00000151576]
AlphaFold Q3URQ7
Predicted Effect probably benign
Transcript: ENSMUST00000047282
SMART Domains Protein: ENSMUSP00000044172
Gene: ENSMUSG00000031816

DomainStartEndE-ValueType
Pfam:5-FTHF_cyc-lig 1 187 1.1e-31 PFAM
RRM 278 346 2.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116415
SMART Domains Protein: ENSMUSP00000112116
Gene: ENSMUSG00000031816

DomainStartEndE-ValueType
Pfam:5-FTHF_cyc-lig 9 206 2.3e-36 PFAM
RRM 297 365 2.27e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000126431
AA Change: V133A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000119673
Gene: ENSMUSG00000031816
AA Change: V133A

DomainStartEndE-ValueType
low complexity region 44 54 N/A INTRINSIC
Pfam:5-FTHF_cyc-lig 81 278 5.2e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128052
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128503
Predicted Effect probably damaging
Transcript: ENSMUST00000133037
AA Change: V61A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117429
Gene: ENSMUSG00000031816
AA Change: V61A

DomainStartEndE-ValueType
Pfam:5-FTHF_cyc-lig 9 206 7.8e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133058
Predicted Effect probably damaging
Transcript: ENSMUST00000134758
AA Change: V42A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138908
Predicted Effect probably damaging
Transcript: ENSMUST00000139782
AA Change: V42A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115382
Gene: ENSMUSG00000031816
AA Change: V42A

DomainStartEndE-ValueType
Pfam:5-FTHF_cyc-lig 1 187 2.1e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145991
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140260
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156606
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213028
Predicted Effect probably benign
Transcript: ENSMUST00000151576
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149718
Meta Mutation Damage Score 0.7832 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b G A 11: 109,872,551 (GRCm39) Q17* probably null Het
Acap2 T A 16: 30,938,245 (GRCm39) N293I probably damaging Het
Adgrg4 G A X: 55,964,109 (GRCm39) V1893I possibly damaging Het
Aff1 T C 5: 103,966,854 (GRCm39) probably null Het
Ap1b1 A G 11: 4,981,637 (GRCm39) D515G probably damaging Het
Brk1 T C 6: 113,592,805 (GRCm39) Y63H possibly damaging Het
Cand1 T C 10: 119,047,750 (GRCm39) D580G probably damaging Het
Casp4 A G 9: 5,328,451 (GRCm39) D311G probably benign Het
Crygs C T 16: 22,624,301 (GRCm39) G102D possibly damaging Het
Ctnnd2 G T 15: 30,972,973 (GRCm39) V1033F probably damaging Het
Dhx29 G T 13: 113,064,483 (GRCm39) A53S probably benign Het
Dis3 T G 14: 99,332,752 (GRCm39) I227L probably benign Het
Efhc2 T C X: 17,096,789 (GRCm39) N186S possibly damaging Het
Efl1 T C 7: 82,400,024 (GRCm39) V592A probably damaging Het
Elovl7 A T 13: 108,419,040 (GRCm39) Q224L possibly damaging Het
Fcgr3 T A 1: 170,881,644 (GRCm39) K160N probably benign Het
Flg A G 3: 93,187,169 (GRCm39) Y207C probably benign Het
Fmn2 A G 1: 174,409,521 (GRCm39) T585A unknown Het
Gm7135 T C 1: 97,397,620 (GRCm39) noncoding transcript Het
Gm8104 G T 14: 42,959,091 (GRCm39) D94Y probably damaging Het
Hjurp G C 1: 88,204,937 (GRCm39) probably benign Het
Ino80b G C 6: 83,099,314 (GRCm39) P178R probably damaging Het
Kbtbd4 T C 2: 90,740,099 (GRCm39) F495L probably damaging Het
Lingo2 T C 4: 35,709,810 (GRCm39) I57V probably benign Het
Me2 T C 18: 73,924,156 (GRCm39) K352R probably benign Het
Nav2 T A 7: 49,222,046 (GRCm39) probably null Het
Nav2 T A 7: 49,246,979 (GRCm39) I2168N probably damaging Het
Nlrp10 T A 7: 108,523,548 (GRCm39) D644V possibly damaging Het
Oplah C T 15: 76,186,910 (GRCm39) R635H probably damaging Het
Or10n1 A G 9: 39,525,253 (GRCm39) Y130C possibly damaging Het
Or2c1 T C 16: 3,657,434 (GRCm39) L199P probably damaging Het
Or5b117 T C 19: 13,431,835 (GRCm39) I15M probably benign Het
Peli1 A G 11: 21,097,115 (GRCm39) probably null Het
Pfkfb1 A T X: 149,405,184 (GRCm39) D208V possibly damaging Het
Pld5 T G 1: 175,821,441 (GRCm39) T242P probably damaging Het
Rbm5 A G 9: 107,627,682 (GRCm39) S420P probably benign Het
Rhag A T 17: 41,142,544 (GRCm39) I250F probably damaging Het
Rnase4 A G 14: 51,342,462 (GRCm39) K62R probably benign Het
Scaf4 C T 16: 90,057,103 (GRCm39) V83I unknown Het
Slc24a2 A G 4: 87,145,442 (GRCm39) V204A probably damaging Het
Slc5a8 G T 10: 88,747,275 (GRCm39) L409F probably damaging Het
Spns3 A T 11: 72,429,187 (GRCm39) V199E probably damaging Het
Sspo A G 6: 48,455,227 (GRCm39) T3030A probably benign Het
Sstr2 A C 11: 113,515,482 (GRCm39) T134P probably damaging Het
Stk39 G T 2: 68,051,264 (GRCm39) T527K probably benign Het
Sult2a1 T A 7: 13,535,472 (GRCm39) T194S probably benign Het
Tamm41 AGGG AGG 6: 114,989,320 (GRCm39) probably benign Het
Trav7-3 A G 14: 53,681,203 (GRCm39) T82A probably benign Het
Umodl1 G A 17: 31,178,341 (GRCm39) V106I probably damaging Het
Vmn2r85 A C 10: 130,254,574 (GRCm39) C703W probably damaging Het
Vmn2r92 G A 17: 18,404,523 (GRCm39) V556M possibly damaging Het
Zfp292 T C 4: 34,806,079 (GRCm39) I2322V probably benign Het
Zfp644 T C 5: 106,766,142 (GRCm39) E93G probably damaging Het
Zfp81 C T 17: 33,553,890 (GRCm39) C308Y probably damaging Het
Other mutations in Mthfsd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Mthfsd APN 8 121,831,207 (GRCm39) missense probably damaging 1.00
IGL03002:Mthfsd APN 8 121,835,018 (GRCm39) splice site probably benign
R0076:Mthfsd UTSW 8 121,825,478 (GRCm39) missense probably benign 0.04
R0416:Mthfsd UTSW 8 121,827,976 (GRCm39) missense probably damaging 1.00
R0745:Mthfsd UTSW 8 121,829,688 (GRCm39) missense probably damaging 1.00
R2157:Mthfsd UTSW 8 121,828,240 (GRCm39) missense probably damaging 1.00
R2851:Mthfsd UTSW 8 121,832,512 (GRCm39) missense probably benign 0.38
R3439:Mthfsd UTSW 8 121,825,860 (GRCm39) missense possibly damaging 0.89
R4456:Mthfsd UTSW 8 121,832,504 (GRCm39) missense possibly damaging 0.89
R4757:Mthfsd UTSW 8 121,825,737 (GRCm39) critical splice donor site probably null
R5154:Mthfsd UTSW 8 121,825,479 (GRCm39) missense probably damaging 1.00
R5208:Mthfsd UTSW 8 121,835,058 (GRCm39) unclassified probably benign
R5496:Mthfsd UTSW 8 121,825,553 (GRCm39) nonsense probably null
R6652:Mthfsd UTSW 8 121,825,560 (GRCm39) missense probably damaging 1.00
R7309:Mthfsd UTSW 8 121,835,070 (GRCm39) unclassified probably benign
R7538:Mthfsd UTSW 8 121,825,525 (GRCm39) missense probably benign 0.41
R8072:Mthfsd UTSW 8 121,825,555 (GRCm39) missense probably damaging 1.00
R9759:Mthfsd UTSW 8 121,824,615 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGGAGACTTCGTATCAGACTTC -3'
(R):5'- TGCAAGCTTTCCATGTGGC -3'

Sequencing Primer
(F):5'- GACTTCGTATCAGACTTCTAACTGAG -3'
(R):5'- AGCTTTCCATGTGGCCAGAAC -3'
Posted On 2015-06-10