Mutagenetix > Incidental Mutation

Incidental Mutation 'R4207:Slc5a8'

318976

Institutional Source

Beutler Lab

Gene Symbol

Slc5a8

Ensembl Gene

ENSMUSG00000020062

Gene Name

solute carrier family 5 (iodide transporter), member 8

Synonyms

SMCT

MMRRC Submission

041036-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4207 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

88885992-88929515 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 88911413 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 409 (L409F)

Ref Sequence

ENSEMBL: ENSMUSP00000020255 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020255]

AlphaFold

Q8BYF6

Predicted Effect

probably damaging
Transcript: ENSMUST00000020255
AA Change: L409F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000020255
Gene: ENSMUSG00000020062
AA Change: L409F

Domain	Start	End	E-Value	Type
transmembrane domain	10	32	N/A	INTRINSIC
Pfam:SSF	45	449	2.6e-38	PFAM
low complexity region	462	478	N/A	INTRINSIC
transmembrane domain	519	541	N/A	INTRINSIC

Meta Mutation Damage Score

0.2325

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.5%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC5A8 has been shown to transport iodide by a passive mechanism (Rodriguez et al., 2002 [PubMed 12107270]) and monocarboxylates and short-chain fatty acids by a sodium-coupled mechanism (Gopal et al., 2004 [PubMed 15322102]). In kidney, SLC5A8 functions as a high-affinity sodium-coupled lactate transporter involved in reabsorption of lactate and maintenance of blood lactate levels (Thangaraju et al., 2006 [PubMed 16873376]).[supplied by OMIM, Dec 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased lactate concentrations in the saliva and urine. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	G	A	11: 109,981,725	Q17*	probably null	Het
Acap2	T	A	16: 31,119,427	N293I	probably damaging	Het
Adgrg4	G	A	X: 56,918,749	V1893I	possibly damaging	Het
Aff1	T	C	5: 103,818,988		probably null	Het
Ap1b1	A	G	11: 5,031,637	D515G	probably damaging	Het
Brk1	T	C	6: 113,615,844	Y63H	possibly damaging	Het
Cand1	T	C	10: 119,211,845	D580G	probably damaging	Het
Casp4	A	G	9: 5,328,451	D311G	probably benign	Het
Crygs	C	T	16: 22,805,551	G102D	possibly damaging	Het
Ctnnd2	G	T	15: 30,972,827	V1033F	probably damaging	Het
Dhx29	G	T	13: 112,927,949	A53S	probably benign	Het
Dis3	T	G	14: 99,095,316	I227L	probably benign	Het
Efhc2	T	C	X: 17,230,550	N186S	possibly damaging	Het
Efl1	T	C	7: 82,750,816	V592A	probably damaging	Het
Elovl7	A	T	13: 108,282,506	Q224L	possibly damaging	Het
Fcgr3	T	A	1: 171,054,075	K160N	probably benign	Het
Flg	A	G	3: 93,279,862	Y207C	probably benign	Het
Fmn2	A	G	1: 174,581,955	T585A	unknown	Het
Gm7135	T	C	1: 97,469,895		noncoding transcript	Het
Gm8104	G	T	14: 43,101,634	D94Y	probably damaging	Het
Hjurp	G	C	1: 88,277,215		probably benign	Het
Ino80b	G	C	6: 83,122,333	P178R	probably damaging	Het
Kbtbd4	T	C	2: 90,909,755	F495L	probably damaging	Het
Lingo2	T	C	4: 35,709,810	I57V	probably benign	Het
Me2	T	C	18: 73,791,085	K352R	probably benign	Het
Mthfsd	A	G	8: 121,105,626	V133A	probably damaging	Het
Nav2	T	A	7: 49,572,298		probably null	Het
Nav2	T	A	7: 49,597,231	I2168N	probably damaging	Het
Nlrp10	T	A	7: 108,924,341	D644V	possibly damaging	Het
Olfr1472	T	C	19: 13,454,471	I15M	probably benign	Het
Olfr148	A	G	9: 39,613,957	Y130C	possibly damaging	Het
Olfr15	T	C	16: 3,839,570	L199P	probably damaging	Het
Oplah	C	T	15: 76,302,710	R635H	probably damaging	Het
Peli1	A	G	11: 21,147,115		probably null	Het
Pfkfb1	A	T	X: 150,622,188	D208V	possibly damaging	Het
Pld5	T	G	1: 175,993,875	T242P	probably damaging	Het
Rbm5	A	G	9: 107,750,483	S420P	probably benign	Het
Rhag	A	T	17: 40,831,653	I250F	probably damaging	Het
Rnase4	A	G	14: 51,105,005	K62R	probably benign	Het
Scaf4	C	T	16: 90,260,215	V83I	unknown	Het
Slc24a2	A	G	4: 87,227,205	V204A	probably damaging	Het
Spns3	A	T	11: 72,538,361	V199E	probably damaging	Het
Sspo	A	G	6: 48,478,293	T3030A	probably benign	Het
Sstr2	A	C	11: 113,624,656	T134P	probably damaging	Het
Stk39	G	T	2: 68,220,920	T527K	probably benign	Het
Sult2a1	T	A	7: 13,801,547	T194S	probably benign	Het
Tamm41	AGGG	AGG	6: 115,012,359		probably benign	Het
Trav7-3	A	G	14: 53,443,746	T82A	probably benign	Het
Umodl1	G	A	17: 30,959,367	V106I	probably damaging	Het
Vmn2r85	A	C	10: 130,418,705	C703W	probably damaging	Het
Vmn2r92	G	A	17: 18,184,261	V556M	possibly damaging	Het
Zfp292	T	C	4: 34,806,079	I2322V	probably benign	Het
Zfp644	T	C	5: 106,618,276	E93G	probably damaging	Het
Zfp81	C	T	17: 33,334,916	C308Y	probably damaging	Het

Other mutations in Slc5a8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00507:Slc5a8	APN	10	88908040	missense	possibly damaging	0.91
IGL00902:Slc5a8	APN	10	88919461	missense	probably benign	0.03
IGL00960:Slc5a8	APN	10	88921765	missense	probably benign	0.21
IGL01109:Slc5a8	APN	10	88906392	missense	possibly damaging	0.95
IGL01365:Slc5a8	APN	10	88892097	splice site	probably benign
IGL01418:Slc5a8	APN	10	88905033	missense	probably damaging	1.00
IGL01823:Slc5a8	APN	10	88919472	nonsense	probably null
IGL02116:Slc5a8	APN	10	88919500	missense	probably benign
IGL03109:Slc5a8	APN	10	88906416	splice site	probably benign
PIT4585001:Slc5a8	UTSW	10	88886503	missense	probably damaging	1.00
R0010:Slc5a8	UTSW	10	88886590	missense	probably benign	0.03
R0418:Slc5a8	UTSW	10	88886558	missense	probably benign	0.01
R1233:Slc5a8	UTSW	10	88918442	missense	probably damaging	1.00
R1656:Slc5a8	UTSW	10	88925786	critical splice donor site	probably null
R1769:Slc5a8	UTSW	10	88919464	missense	probably benign
R1769:Slc5a8	UTSW	10	88919466	nonsense	probably null
R2870:Slc5a8	UTSW	10	88904963	missense	probably benign	0.01
R2870:Slc5a8	UTSW	10	88904963	missense	probably benign	0.01
R2873:Slc5a8	UTSW	10	88904963	missense	probably benign	0.01
R3883:Slc5a8	UTSW	10	88902463	missense	possibly damaging	0.89
R4731:Slc5a8	UTSW	10	88925787	critical splice donor site	probably null
R4880:Slc5a8	UTSW	10	88892024	missense	probably damaging	1.00
R4969:Slc5a8	UTSW	10	88904912	splice site	probably null
R4998:Slc5a8	UTSW	10	88908057	critical splice donor site	probably null
R5009:Slc5a8	UTSW	10	88909654	missense	probably benign	0.07
R5068:Slc5a8	UTSW	10	88886598	missense	possibly damaging	0.82
R5069:Slc5a8	UTSW	10	88886598	missense	possibly damaging	0.82
R5070:Slc5a8	UTSW	10	88886598	missense	possibly damaging	0.82
R5130:Slc5a8	UTSW	10	88926215	missense	probably benign
R5141:Slc5a8	UTSW	10	88919560	critical splice donor site	probably null
R5252:Slc5a8	UTSW	10	88906347	missense	probably damaging	1.00
R5659:Slc5a8	UTSW	10	88919428	missense	possibly damaging	0.89
R5660:Slc5a8	UTSW	10	88919428	missense	possibly damaging	0.89
R5661:Slc5a8	UTSW	10	88919428	missense	possibly damaging	0.89
R6039:Slc5a8	UTSW	10	88886574	missense	probably benign	0.00
R6039:Slc5a8	UTSW	10	88886574	missense	probably benign	0.00
R6378:Slc5a8	UTSW	10	88905054	missense	probably damaging	1.00
R7214:Slc5a8	UTSW	10	88919502	missense	probably benign
R7255:Slc5a8	UTSW	10	88909631	missense	probably damaging	1.00
R7526:Slc5a8	UTSW	10	88902491	missense	probably damaging	1.00
R7604:Slc5a8	UTSW	10	88904960	missense	possibly damaging	0.78
R7688:Slc5a8	UTSW	10	88921699	missense	probably damaging	1.00
R7869:Slc5a8	UTSW	10	88921705	missense	probably benign	0.15
R8219:Slc5a8	UTSW	10	88921699	missense	probably damaging	1.00
R8474:Slc5a8	UTSW	10	88921690	missense	possibly damaging	0.69
R8937:Slc5a8	UTSW	10	88905023	missense	probably damaging	1.00
R8960:Slc5a8	UTSW	10	88886173	start gained	probably benign
R9000:Slc5a8	UTSW	10	88926227	missense	probably benign	0.00
R9000:Slc5a8	UTSW	10	88926228	missense	probably benign	0.13
R9792:Slc5a8	UTSW	10	88921729	missense	possibly damaging	0.55
R9795:Slc5a8	UTSW	10	88921729	missense	possibly damaging	0.55
Z1177:Slc5a8	UTSW	10	88909613	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAGGAAAAGGCCTCTTTCCTTG -3'
(R):5'- GGCATGCATACACATATACAAGG -3'

Sequencing Primer
(F):5'- CTTGTCTCACTGACTTTAATGTGG -3'
(R):5'- TGCATACACATATACAAGGAAAAGG -3'

Posted On

2015-06-10