Mutagenetix > Incidental Mutation

Incidental Mutation 'R4207:Cand1'

318977

Institutional Source

Beutler Lab

Gene Symbol

Cand1

Ensembl Gene

ENSMUSG00000020114

Gene Name

cullin associated and neddylation disassociated 1

Synonyms

D10Ertd516e, 2310038O07Rik, 6330512O03Rik

MMRRC Submission

041036-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4207 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

119199255-119240055 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 119211845 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 580 (D580G)

Ref Sequence

ENSEMBL: ENSMUSP00000020315 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020315] [ENSMUST00000126373]

AlphaFold

Q6ZQ38

Predicted Effect

probably damaging
Transcript: ENSMUST00000020315
AA Change: D580G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000020315
Gene: ENSMUSG00000020114
AA Change: D580G

Domain	Start	End	E-Value	Type
SCOP:d1qgra_	53	994	4e-44	SMART
Pfam:TIP120	1040	1203	1.9e-68	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000126373

SMART Domains

Protein: ENSMUSP00000115234
Gene: ENSMUSG00000020114

Domain	Start	End	E-Value	Type
Pfam:HEAT	56	86	2.1e-5	PFAM
low complexity region	124	135	N/A	INTRINSIC
Pfam:HEAT_EZ	155	209	3.7e-6	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148802

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149155

Meta Mutation Damage Score

0.5694

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.5%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an essential regulator of Cullin-RING ubiquitin ligases, which are in involved in ubiquitinylation of proteins degraded by the Ub proteasome system. The encoded protein binds to unneddylated cullin-RING box protein complexes and acts as an inhibitor of cullin neddylation and of Skp1, cullin, and F box ubiquitin ligase complex assembly and activity. In mammalian cell culture, this protein predominantly localizes to the cytoplasm. Knockdown of this gene in preadipocytes results in blocked adipogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	G	A	11: 109,981,725	Q17*	probably null	Het
Acap2	T	A	16: 31,119,427	N293I	probably damaging	Het
Adgrg4	G	A	X: 56,918,749	V1893I	possibly damaging	Het
Aff1	T	C	5: 103,818,988		probably null	Het
Ap1b1	A	G	11: 5,031,637	D515G	probably damaging	Het
Brk1	T	C	6: 113,615,844	Y63H	possibly damaging	Het
Casp4	A	G	9: 5,328,451	D311G	probably benign	Het
Crygs	C	T	16: 22,805,551	G102D	possibly damaging	Het
Ctnnd2	G	T	15: 30,972,827	V1033F	probably damaging	Het
Dhx29	G	T	13: 112,927,949	A53S	probably benign	Het
Dis3	T	G	14: 99,095,316	I227L	probably benign	Het
Efhc2	T	C	X: 17,230,550	N186S	possibly damaging	Het
Efl1	T	C	7: 82,750,816	V592A	probably damaging	Het
Elovl7	A	T	13: 108,282,506	Q224L	possibly damaging	Het
Fcgr3	T	A	1: 171,054,075	K160N	probably benign	Het
Flg	A	G	3: 93,279,862	Y207C	probably benign	Het
Fmn2	A	G	1: 174,581,955	T585A	unknown	Het
Gm7135	T	C	1: 97,469,895		noncoding transcript	Het
Gm8104	G	T	14: 43,101,634	D94Y	probably damaging	Het
Hjurp	G	C	1: 88,277,215		probably benign	Het
Ino80b	G	C	6: 83,122,333	P178R	probably damaging	Het
Kbtbd4	T	C	2: 90,909,755	F495L	probably damaging	Het
Lingo2	T	C	4: 35,709,810	I57V	probably benign	Het
Me2	T	C	18: 73,791,085	K352R	probably benign	Het
Mthfsd	A	G	8: 121,105,626	V133A	probably damaging	Het
Nav2	T	A	7: 49,572,298		probably null	Het
Nav2	T	A	7: 49,597,231	I2168N	probably damaging	Het
Nlrp10	T	A	7: 108,924,341	D644V	possibly damaging	Het
Olfr1472	T	C	19: 13,454,471	I15M	probably benign	Het
Olfr148	A	G	9: 39,613,957	Y130C	possibly damaging	Het
Olfr15	T	C	16: 3,839,570	L199P	probably damaging	Het
Oplah	C	T	15: 76,302,710	R635H	probably damaging	Het
Peli1	A	G	11: 21,147,115		probably null	Het
Pfkfb1	A	T	X: 150,622,188	D208V	possibly damaging	Het
Pld5	T	G	1: 175,993,875	T242P	probably damaging	Het
Rbm5	A	G	9: 107,750,483	S420P	probably benign	Het
Rhag	A	T	17: 40,831,653	I250F	probably damaging	Het
Rnase4	A	G	14: 51,105,005	K62R	probably benign	Het
Scaf4	C	T	16: 90,260,215	V83I	unknown	Het
Slc24a2	A	G	4: 87,227,205	V204A	probably damaging	Het
Slc5a8	G	T	10: 88,911,413	L409F	probably damaging	Het
Spns3	A	T	11: 72,538,361	V199E	probably damaging	Het
Sspo	A	G	6: 48,478,293	T3030A	probably benign	Het
Sstr2	A	C	11: 113,624,656	T134P	probably damaging	Het
Stk39	G	T	2: 68,220,920	T527K	probably benign	Het
Sult2a1	T	A	7: 13,801,547	T194S	probably benign	Het
Tamm41	AGGG	AGG	6: 115,012,359		probably benign	Het
Trav7-3	A	G	14: 53,443,746	T82A	probably benign	Het
Umodl1	G	A	17: 30,959,367	V106I	probably damaging	Het
Vmn2r85	A	C	10: 130,418,705	C703W	probably damaging	Het
Vmn2r92	G	A	17: 18,184,261	V556M	possibly damaging	Het
Zfp292	T	C	4: 34,806,079	I2322V	probably benign	Het
Zfp644	T	C	5: 106,618,276	E93G	probably damaging	Het
Zfp81	C	T	17: 33,334,916	C308Y	probably damaging	Het

Other mutations in Cand1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00850:Cand1	APN	10	119211135	missense	probably benign	0.00
IGL00917:Cand1	APN	10	119210936	missense	possibly damaging	0.87
IGL01383:Cand1	APN	10	119208167	missense	probably damaging	0.96
IGL02016:Cand1	APN	10	119212568	missense	probably damaging	0.98
IGL02271:Cand1	APN	10	119211721	missense	probably damaging	1.00
IGL02282:Cand1	APN	10	119210709	missense	probably benign	0.26
IGL02494:Cand1	APN	10	119213617	missense	probably benign
IGL02527:Cand1	APN	10	119206807	missense	probably damaging	1.00
IGL02675:Cand1	APN	10	119219697	missense	probably damaging	0.99
IGL02796:Cand1	UTSW	10	119213638	missense	probably damaging	1.00
R0114:Cand1	UTSW	10	119216522	missense	probably benign
R0667:Cand1	UTSW	10	119216520	missense	probably benign	0.00
R1589:Cand1	UTSW	10	119213566	missense	probably damaging	0.97
R1591:Cand1	UTSW	10	119211869	missense	possibly damaging	0.63
R1626:Cand1	UTSW	10	119210014	missense	possibly damaging	0.46
R1771:Cand1	UTSW	10	119208306	missense	probably benign	0.05
R1937:Cand1	UTSW	10	119203020	missense	probably damaging	1.00
R1951:Cand1	UTSW	10	119208020	splice site	probably benign
R1990:Cand1	UTSW	10	119210067	missense	probably damaging	1.00
R3522:Cand1	UTSW	10	119239197	missense	probably benign	0.01
R4209:Cand1	UTSW	10	119211558	missense	probably benign	0.24
R4502:Cand1	UTSW	10	119216667	missense	probably benign
R4791:Cand1	UTSW	10	119210702	missense	probably benign	0.02
R4841:Cand1	UTSW	10	119213546	critical splice donor site	probably null
R4842:Cand1	UTSW	10	119213546	critical splice donor site	probably null
R5326:Cand1	UTSW	10	119212028	missense	probably benign
R5606:Cand1	UTSW	10	119211454	missense	possibly damaging	0.63
R5613:Cand1	UTSW	10	119215323	missense	possibly damaging	0.93
R5768:Cand1	UTSW	10	119211005	missense	probably benign	0.06
R5884:Cand1	UTSW	10	119213765	missense	possibly damaging	0.90
R6006:Cand1	UTSW	10	119210028	missense	possibly damaging	0.83
R6062:Cand1	UTSW	10	119218010	missense	possibly damaging	0.89
R6734:Cand1	UTSW	10	119211992	missense	possibly damaging	0.67
R6838:Cand1	UTSW	10	119210030	missense	probably benign	0.21
R7058:Cand1	UTSW	10	119211754	missense	probably benign	0.00
R7342:Cand1	UTSW	10	119211787	missense	possibly damaging	0.64
R7425:Cand1	UTSW	10	119216243	missense	probably benign	0.00
R7705:Cand1	UTSW	10	119212438	critical splice donor site	probably null
R7812:Cand1	UTSW	10	119217959	missense	probably benign	0.04
R7916:Cand1	UTSW	10	119216588	missense	probably benign	0.00
R7982:Cand1	UTSW	10	119216473	missense	probably damaging	0.97
R8117:Cand1	UTSW	10	119206816	missense	probably damaging	1.00
R9388:Cand1	UTSW	10	119211308	missense	possibly damaging	0.62
Z1176:Cand1	UTSW	10	119239194	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CACAGGCCTCAGATCTATCTTC -3'
(R):5'- ATCCTCATGTTCAGGCTCTGG -3'

Sequencing Primer
(F):5'- GGCCTCAGATCTATCTTCAAAGGTG -3'
(R):5'- ATGTTCAGGCTCTGGTCCCTC -3'

Posted On

2015-06-10