Incidental Mutation 'R4207:Vmn2r85'
ID 318978
Institutional Source Beutler Lab
Gene Symbol Vmn2r85
Ensembl Gene ENSMUSG00000092048
Gene Name vomeronasal 2, receptor 85
Synonyms EG623734
MMRRC Submission 041036-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.067) question?
Stock # R4207 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 130417772-130429612 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 130418705 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tryptophan at position 703 (C703W)
Ref Sequence ENSEMBL: ENSMUSP00000128792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171811]
AlphaFold G3UW56
Predicted Effect probably damaging
Transcript: ENSMUST00000171811
AA Change: C703W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128792
Gene: ENSMUSG00000092048
AA Change: C703W

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 77 425 9e-26 PFAM
Pfam:NCD3G 508 562 1.1e-18 PFAM
Pfam:7tm_3 595 831 3.7e-54 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b G A 11: 109,981,725 Q17* probably null Het
Acap2 T A 16: 31,119,427 N293I probably damaging Het
Adgrg4 G A X: 56,918,749 V1893I possibly damaging Het
Aff1 T C 5: 103,818,988 probably null Het
Ap1b1 A G 11: 5,031,637 D515G probably damaging Het
Brk1 T C 6: 113,615,844 Y63H possibly damaging Het
Cand1 T C 10: 119,211,845 D580G probably damaging Het
Casp4 A G 9: 5,328,451 D311G probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Ctnnd2 G T 15: 30,972,827 V1033F probably damaging Het
Dhx29 G T 13: 112,927,949 A53S probably benign Het
Dis3 T G 14: 99,095,316 I227L probably benign Het
Efhc2 T C X: 17,230,550 N186S possibly damaging Het
Efl1 T C 7: 82,750,816 V592A probably damaging Het
Elovl7 A T 13: 108,282,506 Q224L possibly damaging Het
Fcgr3 T A 1: 171,054,075 K160N probably benign Het
Flg A G 3: 93,279,862 Y207C probably benign Het
Fmn2 A G 1: 174,581,955 T585A unknown Het
Gm7135 T C 1: 97,469,895 noncoding transcript Het
Gm8104 G T 14: 43,101,634 D94Y probably damaging Het
Hjurp G C 1: 88,277,215 probably benign Het
Ino80b G C 6: 83,122,333 P178R probably damaging Het
Kbtbd4 T C 2: 90,909,755 F495L probably damaging Het
Lingo2 T C 4: 35,709,810 I57V probably benign Het
Me2 T C 18: 73,791,085 K352R probably benign Het
Mthfsd A G 8: 121,105,626 V133A probably damaging Het
Nav2 T A 7: 49,572,298 probably null Het
Nav2 T A 7: 49,597,231 I2168N probably damaging Het
Nlrp10 T A 7: 108,924,341 D644V possibly damaging Het
Olfr1472 T C 19: 13,454,471 I15M probably benign Het
Olfr148 A G 9: 39,613,957 Y130C possibly damaging Het
Olfr15 T C 16: 3,839,570 L199P probably damaging Het
Oplah C T 15: 76,302,710 R635H probably damaging Het
Peli1 A G 11: 21,147,115 probably null Het
Pfkfb1 A T X: 150,622,188 D208V possibly damaging Het
Pld5 T G 1: 175,993,875 T242P probably damaging Het
Rbm5 A G 9: 107,750,483 S420P probably benign Het
Rhag A T 17: 40,831,653 I250F probably damaging Het
Rnase4 A G 14: 51,105,005 K62R probably benign Het
Scaf4 C T 16: 90,260,215 V83I unknown Het
Slc24a2 A G 4: 87,227,205 V204A probably damaging Het
Slc5a8 G T 10: 88,911,413 L409F probably damaging Het
Spns3 A T 11: 72,538,361 V199E probably damaging Het
Sspo A G 6: 48,478,293 T3030A probably benign Het
Sstr2 A C 11: 113,624,656 T134P probably damaging Het
Stk39 G T 2: 68,220,920 T527K probably benign Het
Sult2a1 T A 7: 13,801,547 T194S probably benign Het
Tamm41 AGGG AGG 6: 115,012,359 probably benign Het
Trav7-3 A G 14: 53,443,746 T82A probably benign Het
Umodl1 G A 17: 30,959,367 V106I probably damaging Het
Vmn2r92 G A 17: 18,184,261 V556M possibly damaging Het
Zfp292 T C 4: 34,806,079 I2322V probably benign Het
Zfp644 T C 5: 106,618,276 E93G probably damaging Het
Zfp81 C T 17: 33,334,916 C308Y probably damaging Het
Other mutations in Vmn2r85
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Vmn2r85 APN 10 130418821 missense probably benign 0.22
IGL01298:Vmn2r85 APN 10 130418821 missense probably benign 0.22
IGL01361:Vmn2r85 APN 10 130418821 missense probably benign 0.22
IGL02185:Vmn2r85 APN 10 130418692 missense probably benign 0.13
IGL02505:Vmn2r85 APN 10 130425580 missense probably damaging 1.00
IGL02607:Vmn2r85 APN 10 130426421 missense possibly damaging 0.89
IGL02755:Vmn2r85 APN 10 130425512 missense probably damaging 0.98
IGL03188:Vmn2r85 APN 10 130418743 missense probably benign 0.16
IGL03366:Vmn2r85 APN 10 130426459 missense probably benign 0.00
IGL03397:Vmn2r85 APN 10 130425394 missense probably damaging 1.00
PIT4445001:Vmn2r85 UTSW 10 130425703 missense probably benign 0.00
R0066:Vmn2r85 UTSW 10 130425901 missense probably damaging 1.00
R0128:Vmn2r85 UTSW 10 130419185 splice site probably benign
R0130:Vmn2r85 UTSW 10 130419185 splice site probably benign
R0503:Vmn2r85 UTSW 10 130422740 missense probably damaging 1.00
R0827:Vmn2r85 UTSW 10 130429518 missense possibly damaging 0.89
R1432:Vmn2r85 UTSW 10 130425286 missense possibly damaging 0.74
R1521:Vmn2r85 UTSW 10 130425919 missense probably damaging 0.99
R2029:Vmn2r85 UTSW 10 130425574 nonsense probably null
R2034:Vmn2r85 UTSW 10 130426373 splice site probably benign
R2852:Vmn2r85 UTSW 10 130419166 missense probably benign 0.03
R2853:Vmn2r85 UTSW 10 130419166 missense probably benign 0.03
R3084:Vmn2r85 UTSW 10 130425212 missense probably benign 0.00
R3085:Vmn2r85 UTSW 10 130425212 missense probably benign 0.00
R3430:Vmn2r85 UTSW 10 130418889 missense probably damaging 0.97
R3694:Vmn2r85 UTSW 10 130418302 missense probably damaging 0.99
R3932:Vmn2r85 UTSW 10 130418467 missense probably damaging 1.00
R4628:Vmn2r85 UTSW 10 130425366 missense probably benign 0.00
R4814:Vmn2r85 UTSW 10 130418698 missense probably benign 0.12
R4948:Vmn2r85 UTSW 10 130419121 missense probably damaging 1.00
R4951:Vmn2r85 UTSW 10 130425244 missense probably damaging 1.00
R4959:Vmn2r85 UTSW 10 130421433 missense probably damaging 1.00
R5336:Vmn2r85 UTSW 10 130422705 missense possibly damaging 0.63
R5643:Vmn2r85 UTSW 10 130426474 missense probably damaging 1.00
R6061:Vmn2r85 UTSW 10 130425662 missense probably benign 0.09
R6115:Vmn2r85 UTSW 10 130422803 missense probably damaging 1.00
R6190:Vmn2r85 UTSW 10 130425461 missense possibly damaging 0.88
R6518:Vmn2r85 UTSW 10 130429412 missense probably benign 0.00
R6533:Vmn2r85 UTSW 10 130426660 missense probably benign 0.00
R6610:Vmn2r85 UTSW 10 130425969 missense probably damaging 0.97
R6809:Vmn2r85 UTSW 10 130425926 missense probably benign
R6962:Vmn2r85 UTSW 10 130425583 missense probably damaging 0.99
R7075:Vmn2r85 UTSW 10 130422688 missense probably benign 0.06
R7104:Vmn2r85 UTSW 10 130426507 missense probably benign
R7424:Vmn2r85 UTSW 10 130418980 missense probably damaging 1.00
R7516:Vmn2r85 UTSW 10 130418983 missense probably damaging 1.00
R7537:Vmn2r85 UTSW 10 130422866 missense probably benign 0.01
R7768:Vmn2r85 UTSW 10 130418693 missense probably damaging 1.00
R7810:Vmn2r85 UTSW 10 130425212 missense probably benign 0.00
R8078:Vmn2r85 UTSW 10 130429495 nonsense probably null
R8115:Vmn2r85 UTSW 10 130425951 missense probably benign 0.06
R8262:Vmn2r85 UTSW 10 130418869 missense probably damaging 0.98
R8395:Vmn2r85 UTSW 10 130425928 missense probably damaging 0.99
R8409:Vmn2r85 UTSW 10 130425388 missense probably benign 0.16
R8547:Vmn2r85 UTSW 10 130425442 missense probably damaging 1.00
R8875:Vmn2r85 UTSW 10 130418302 missense probably damaging 0.99
R9035:Vmn2r85 UTSW 10 130425610 missense probably benign
R9040:Vmn2r85 UTSW 10 130418442 missense probably damaging 1.00
R9115:Vmn2r85 UTSW 10 130418284 missense probably benign 0.00
R9182:Vmn2r85 UTSW 10 130429481 missense probably benign 0.00
R9245:Vmn2r85 UTSW 10 130419164 missense possibly damaging 0.92
R9245:Vmn2r85 UTSW 10 130425665 missense probably damaging 1.00
R9405:Vmn2r85 UTSW 10 130425346 missense probably damaging 0.99
R9502:Vmn2r85 UTSW 10 130425518 missense probably damaging 0.99
R9520:Vmn2r85 UTSW 10 130419124 missense probably benign
R9653:Vmn2r85 UTSW 10 130425825 missense probably damaging 0.99
Z1176:Vmn2r85 UTSW 10 130425844 missense probably damaging 0.99
Z1177:Vmn2r85 UTSW 10 130418907 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAAGCCACAGTGAAGCTCC -3'
(R):5'- TGAAGGCCAATAACTGCATTCTC -3'

Sequencing Primer
(F):5'- ACAGTGAAGCTCCCCAGAG -3'
(R):5'- GGCCAATAACTGCATTCTCAGCTAC -3'
Posted On 2015-06-10