Incidental Mutation 'R4207:Vmn2r85'
ID 318978
Institutional Source Beutler Lab
Gene Symbol Vmn2r85
Ensembl Gene ENSMUSG00000092048
Gene Name vomeronasal 2, receptor 85
Synonyms EG623734
MMRRC Submission 041036-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.086) question?
Stock # R4207 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 130253658-130266615 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 130254574 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tryptophan at position 703 (C703W)
Ref Sequence ENSEMBL: ENSMUSP00000128792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171811]
AlphaFold G3UW56
Predicted Effect probably damaging
Transcript: ENSMUST00000171811
AA Change: C703W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128792
Gene: ENSMUSG00000092048
AA Change: C703W

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 77 425 9e-26 PFAM
Pfam:NCD3G 508 562 1.1e-18 PFAM
Pfam:7tm_3 595 831 3.7e-54 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b G A 11: 109,872,551 (GRCm39) Q17* probably null Het
Acap2 T A 16: 30,938,245 (GRCm39) N293I probably damaging Het
Adgrg4 G A X: 55,964,109 (GRCm39) V1893I possibly damaging Het
Aff1 T C 5: 103,966,854 (GRCm39) probably null Het
Ap1b1 A G 11: 4,981,637 (GRCm39) D515G probably damaging Het
Brk1 T C 6: 113,592,805 (GRCm39) Y63H possibly damaging Het
Cand1 T C 10: 119,047,750 (GRCm39) D580G probably damaging Het
Casp4 A G 9: 5,328,451 (GRCm39) D311G probably benign Het
Crygs C T 16: 22,624,301 (GRCm39) G102D possibly damaging Het
Ctnnd2 G T 15: 30,972,973 (GRCm39) V1033F probably damaging Het
Dhx29 G T 13: 113,064,483 (GRCm39) A53S probably benign Het
Dis3 T G 14: 99,332,752 (GRCm39) I227L probably benign Het
Efhc2 T C X: 17,096,789 (GRCm39) N186S possibly damaging Het
Efl1 T C 7: 82,400,024 (GRCm39) V592A probably damaging Het
Elovl7 A T 13: 108,419,040 (GRCm39) Q224L possibly damaging Het
Fcgr3 T A 1: 170,881,644 (GRCm39) K160N probably benign Het
Flg A G 3: 93,187,169 (GRCm39) Y207C probably benign Het
Fmn2 A G 1: 174,409,521 (GRCm39) T585A unknown Het
Gm7135 T C 1: 97,397,620 (GRCm39) noncoding transcript Het
Gm8104 G T 14: 42,959,091 (GRCm39) D94Y probably damaging Het
Hjurp G C 1: 88,204,937 (GRCm39) probably benign Het
Ino80b G C 6: 83,099,314 (GRCm39) P178R probably damaging Het
Kbtbd4 T C 2: 90,740,099 (GRCm39) F495L probably damaging Het
Lingo2 T C 4: 35,709,810 (GRCm39) I57V probably benign Het
Me2 T C 18: 73,924,156 (GRCm39) K352R probably benign Het
Mthfsd A G 8: 121,832,365 (GRCm39) V133A probably damaging Het
Nav2 T A 7: 49,246,979 (GRCm39) I2168N probably damaging Het
Nav2 T A 7: 49,222,046 (GRCm39) probably null Het
Nlrp10 T A 7: 108,523,548 (GRCm39) D644V possibly damaging Het
Oplah C T 15: 76,186,910 (GRCm39) R635H probably damaging Het
Or10n1 A G 9: 39,525,253 (GRCm39) Y130C possibly damaging Het
Or2c1 T C 16: 3,657,434 (GRCm39) L199P probably damaging Het
Or5b117 T C 19: 13,431,835 (GRCm39) I15M probably benign Het
Peli1 A G 11: 21,097,115 (GRCm39) probably null Het
Pfkfb1 A T X: 149,405,184 (GRCm39) D208V possibly damaging Het
Pld5 T G 1: 175,821,441 (GRCm39) T242P probably damaging Het
Rbm5 A G 9: 107,627,682 (GRCm39) S420P probably benign Het
Rhag A T 17: 41,142,544 (GRCm39) I250F probably damaging Het
Rnase4 A G 14: 51,342,462 (GRCm39) K62R probably benign Het
Scaf4 C T 16: 90,057,103 (GRCm39) V83I unknown Het
Slc24a2 A G 4: 87,145,442 (GRCm39) V204A probably damaging Het
Slc5a8 G T 10: 88,747,275 (GRCm39) L409F probably damaging Het
Spns3 A T 11: 72,429,187 (GRCm39) V199E probably damaging Het
Sspo A G 6: 48,455,227 (GRCm39) T3030A probably benign Het
Sstr2 A C 11: 113,515,482 (GRCm39) T134P probably damaging Het
Stk39 G T 2: 68,051,264 (GRCm39) T527K probably benign Het
Sult2a1 T A 7: 13,535,472 (GRCm39) T194S probably benign Het
Tamm41 AGGG AGG 6: 114,989,320 (GRCm39) probably benign Het
Trav7-3 A G 14: 53,681,203 (GRCm39) T82A probably benign Het
Umodl1 G A 17: 31,178,341 (GRCm39) V106I probably damaging Het
Vmn2r92 G A 17: 18,404,523 (GRCm39) V556M possibly damaging Het
Zfp292 T C 4: 34,806,079 (GRCm39) I2322V probably benign Het
Zfp644 T C 5: 106,766,142 (GRCm39) E93G probably damaging Het
Zfp81 C T 17: 33,553,890 (GRCm39) C308Y probably damaging Het
Other mutations in Vmn2r85
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Vmn2r85 APN 10 130,254,690 (GRCm39) missense probably benign 0.22
IGL01298:Vmn2r85 APN 10 130,254,690 (GRCm39) missense probably benign 0.22
IGL01361:Vmn2r85 APN 10 130,254,690 (GRCm39) missense probably benign 0.22
IGL02185:Vmn2r85 APN 10 130,254,561 (GRCm39) missense probably benign 0.13
IGL02505:Vmn2r85 APN 10 130,261,449 (GRCm39) missense probably damaging 1.00
IGL02607:Vmn2r85 APN 10 130,262,290 (GRCm39) missense possibly damaging 0.89
IGL02755:Vmn2r85 APN 10 130,261,381 (GRCm39) missense probably damaging 0.98
IGL03188:Vmn2r85 APN 10 130,254,612 (GRCm39) missense probably benign 0.16
IGL03366:Vmn2r85 APN 10 130,262,328 (GRCm39) missense probably benign 0.00
IGL03397:Vmn2r85 APN 10 130,261,263 (GRCm39) missense probably damaging 1.00
PIT4445001:Vmn2r85 UTSW 10 130,261,572 (GRCm39) missense probably benign 0.00
R0066:Vmn2r85 UTSW 10 130,261,770 (GRCm39) missense probably damaging 1.00
R0128:Vmn2r85 UTSW 10 130,255,054 (GRCm39) splice site probably benign
R0130:Vmn2r85 UTSW 10 130,255,054 (GRCm39) splice site probably benign
R0503:Vmn2r85 UTSW 10 130,258,609 (GRCm39) missense probably damaging 1.00
R0827:Vmn2r85 UTSW 10 130,265,387 (GRCm39) missense possibly damaging 0.89
R1432:Vmn2r85 UTSW 10 130,261,155 (GRCm39) missense possibly damaging 0.74
R1521:Vmn2r85 UTSW 10 130,261,788 (GRCm39) missense probably damaging 0.99
R2029:Vmn2r85 UTSW 10 130,261,443 (GRCm39) nonsense probably null
R2034:Vmn2r85 UTSW 10 130,262,242 (GRCm39) splice site probably benign
R2852:Vmn2r85 UTSW 10 130,255,035 (GRCm39) missense probably benign 0.03
R2853:Vmn2r85 UTSW 10 130,255,035 (GRCm39) missense probably benign 0.03
R3084:Vmn2r85 UTSW 10 130,261,081 (GRCm39) missense probably benign 0.00
R3085:Vmn2r85 UTSW 10 130,261,081 (GRCm39) missense probably benign 0.00
R3430:Vmn2r85 UTSW 10 130,254,758 (GRCm39) missense probably damaging 0.97
R3694:Vmn2r85 UTSW 10 130,254,171 (GRCm39) missense probably damaging 0.99
R3932:Vmn2r85 UTSW 10 130,254,336 (GRCm39) missense probably damaging 1.00
R4628:Vmn2r85 UTSW 10 130,261,235 (GRCm39) missense probably benign 0.00
R4814:Vmn2r85 UTSW 10 130,254,567 (GRCm39) missense probably benign 0.12
R4948:Vmn2r85 UTSW 10 130,254,990 (GRCm39) missense probably damaging 1.00
R4951:Vmn2r85 UTSW 10 130,261,113 (GRCm39) missense probably damaging 1.00
R4959:Vmn2r85 UTSW 10 130,257,302 (GRCm39) missense probably damaging 1.00
R5336:Vmn2r85 UTSW 10 130,258,574 (GRCm39) missense possibly damaging 0.63
R5643:Vmn2r85 UTSW 10 130,262,343 (GRCm39) missense probably damaging 1.00
R6061:Vmn2r85 UTSW 10 130,261,531 (GRCm39) missense probably benign 0.09
R6115:Vmn2r85 UTSW 10 130,258,672 (GRCm39) missense probably damaging 1.00
R6190:Vmn2r85 UTSW 10 130,261,330 (GRCm39) missense possibly damaging 0.88
R6518:Vmn2r85 UTSW 10 130,265,281 (GRCm39) missense probably benign 0.00
R6533:Vmn2r85 UTSW 10 130,262,529 (GRCm39) missense probably benign 0.00
R6610:Vmn2r85 UTSW 10 130,261,838 (GRCm39) missense probably damaging 0.97
R6809:Vmn2r85 UTSW 10 130,261,795 (GRCm39) missense probably benign
R6962:Vmn2r85 UTSW 10 130,261,452 (GRCm39) missense probably damaging 0.99
R7075:Vmn2r85 UTSW 10 130,258,557 (GRCm39) missense probably benign 0.06
R7104:Vmn2r85 UTSW 10 130,262,376 (GRCm39) missense probably benign
R7424:Vmn2r85 UTSW 10 130,254,849 (GRCm39) missense probably damaging 1.00
R7516:Vmn2r85 UTSW 10 130,254,852 (GRCm39) missense probably damaging 1.00
R7537:Vmn2r85 UTSW 10 130,258,735 (GRCm39) missense probably benign 0.01
R7768:Vmn2r85 UTSW 10 130,254,562 (GRCm39) missense probably damaging 1.00
R7810:Vmn2r85 UTSW 10 130,261,081 (GRCm39) missense probably benign 0.00
R8078:Vmn2r85 UTSW 10 130,265,364 (GRCm39) nonsense probably null
R8115:Vmn2r85 UTSW 10 130,261,820 (GRCm39) missense probably benign 0.06
R8262:Vmn2r85 UTSW 10 130,254,738 (GRCm39) missense probably damaging 0.98
R8395:Vmn2r85 UTSW 10 130,261,797 (GRCm39) missense probably damaging 0.99
R8409:Vmn2r85 UTSW 10 130,261,257 (GRCm39) missense probably benign 0.16
R8547:Vmn2r85 UTSW 10 130,261,311 (GRCm39) missense probably damaging 1.00
R8875:Vmn2r85 UTSW 10 130,254,171 (GRCm39) missense probably damaging 0.99
R9035:Vmn2r85 UTSW 10 130,261,479 (GRCm39) missense probably benign
R9040:Vmn2r85 UTSW 10 130,254,311 (GRCm39) missense probably damaging 1.00
R9115:Vmn2r85 UTSW 10 130,254,153 (GRCm39) missense probably benign 0.00
R9182:Vmn2r85 UTSW 10 130,265,350 (GRCm39) missense probably benign 0.00
R9245:Vmn2r85 UTSW 10 130,261,534 (GRCm39) missense probably damaging 1.00
R9245:Vmn2r85 UTSW 10 130,255,033 (GRCm39) missense possibly damaging 0.92
R9405:Vmn2r85 UTSW 10 130,261,215 (GRCm39) missense probably damaging 0.99
R9502:Vmn2r85 UTSW 10 130,261,387 (GRCm39) missense probably damaging 0.99
R9520:Vmn2r85 UTSW 10 130,254,993 (GRCm39) missense probably benign
R9653:Vmn2r85 UTSW 10 130,261,694 (GRCm39) missense probably damaging 0.99
Z1176:Vmn2r85 UTSW 10 130,261,713 (GRCm39) missense probably damaging 0.99
Z1177:Vmn2r85 UTSW 10 130,254,776 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAAGCCACAGTGAAGCTCC -3'
(R):5'- TGAAGGCCAATAACTGCATTCTC -3'

Sequencing Primer
(F):5'- ACAGTGAAGCTCCCCAGAG -3'
(R):5'- GGCCAATAACTGCATTCTCAGCTAC -3'
Posted On 2015-06-10