Mutagenetix > Incidental Mutation

Incidental Mutation 'R4207:Ap1b1'

318979

Institutional Source

Beutler Lab

Gene Symbol

Ap1b1

Ensembl Gene

ENSMUSG00000009090

Gene Name

adaptor protein complex AP-1, beta 1 subunit

Synonyms

Adtb1, beta-prime adaptin

MMRRC Submission

041036-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.681) question?

Stock #

R4207 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

4986824-5042791 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 5031637 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 515 (D515G)

Ref Sequence

ENSEMBL: ENSMUSP00000009234 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000009234] [ENSMUST00000101613] [ENSMUST00000109897]

AlphaFold

O35643

Predicted Effect

probably damaging
Transcript: ENSMUST00000009234
AA Change: D515G

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000009234
Gene: ENSMUSG00000009090
AA Change: D515G

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	1.5e-174	PFAM
Pfam:HEAT_2	88	157	3.2e-8	PFAM
Pfam:Cnd1	99	268	4.1e-41	PFAM
low complexity region	594	616	N/A	INTRINSIC
low complexity region	626	638	N/A	INTRINSIC
low complexity region	657	670	N/A	INTRINSIC
low complexity region	674	686	N/A	INTRINSIC
Alpha_adaptinC2	713	823	3.38e-18	SMART
B2-adapt-app_C	832	942	4.6e-51	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000101613
AA Change: D488G

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000099134
Gene: ENSMUSG00000009090
AA Change: D488G

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	179	7.5e-61	PFAM
Pfam:HEAT_2	88	179	2e-9	PFAM
Pfam:Cnd1	99	176	2.4e-19	PFAM
Pfam:Cnd1	174	241	1.9e-10	PFAM
Pfam:Adaptin_N	176	507	3.8e-102	PFAM
low complexity region	567	589	N/A	INTRINSIC
low complexity region	599	611	N/A	INTRINSIC
low complexity region	630	642	N/A	INTRINSIC
low complexity region	654	666	N/A	INTRINSIC
Alpha_adaptinC2	693	803	3.38e-18	SMART
B2-adapt-app_C	812	922	4.6e-51	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000109897
AA Change: D488G

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000105523
Gene: ENSMUSG00000009090
AA Change: D488G

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	179	1.2e-60	PFAM
Pfam:HEAT_2	88	185	3.9e-10	PFAM
Pfam:Cnd1	99	175	5e-20	PFAM
Pfam:Cnd1	174	241	1.7e-7	PFAM
Pfam:Adaptin_N	176	507	4.9e-102	PFAM
low complexity region	567	589	N/A	INTRINSIC
low complexity region	599	611	N/A	INTRINSIC
low complexity region	630	643	N/A	INTRINSIC
low complexity region	647	659	N/A	INTRINSIC
Alpha_adaptinC2	686	796	3.38e-18	SMART
B2-adapt-app_C	805	915	4.6e-51	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145704

Meta Mutation Damage Score

0.7538

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.5%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor protein complex 1 is found at the cytoplasmic face of coated vesicles located at the Golgi complex, where it mediates both the recruitment of clathrin to the membrane and the recognition of sorting signals within the cytosolic tails of transmembrane receptors. This complex is a heterotetramer composed of two large, one medium, and one small adaptin subunit. The protein encoded by this gene serves as one of the large subunits of this complex and is a member of the adaptin protein family. This gene is a candidate meningioma gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	G	A	11: 109,981,725	Q17*	probably null	Het
Acap2	T	A	16: 31,119,427	N293I	probably damaging	Het
Adgrg4	G	A	X: 56,918,749	V1893I	possibly damaging	Het
Aff1	T	C	5: 103,818,988		probably null	Het
Brk1	T	C	6: 113,615,844	Y63H	possibly damaging	Het
Cand1	T	C	10: 119,211,845	D580G	probably damaging	Het
Casp4	A	G	9: 5,328,451	D311G	probably benign	Het
Crygs	C	T	16: 22,805,551	G102D	possibly damaging	Het
Ctnnd2	G	T	15: 30,972,827	V1033F	probably damaging	Het
Dhx29	G	T	13: 112,927,949	A53S	probably benign	Het
Dis3	T	G	14: 99,095,316	I227L	probably benign	Het
Efhc2	T	C	X: 17,230,550	N186S	possibly damaging	Het
Efl1	T	C	7: 82,750,816	V592A	probably damaging	Het
Elovl7	A	T	13: 108,282,506	Q224L	possibly damaging	Het
Fcgr3	T	A	1: 171,054,075	K160N	probably benign	Het
Flg	A	G	3: 93,279,862	Y207C	probably benign	Het
Fmn2	A	G	1: 174,581,955	T585A	unknown	Het
Gm7135	T	C	1: 97,469,895		noncoding transcript	Het
Gm8104	G	T	14: 43,101,634	D94Y	probably damaging	Het
Hjurp	G	C	1: 88,277,215		probably benign	Het
Ino80b	G	C	6: 83,122,333	P178R	probably damaging	Het
Kbtbd4	T	C	2: 90,909,755	F495L	probably damaging	Het
Lingo2	T	C	4: 35,709,810	I57V	probably benign	Het
Me2	T	C	18: 73,791,085	K352R	probably benign	Het
Mthfsd	A	G	8: 121,105,626	V133A	probably damaging	Het
Nav2	T	A	7: 49,572,298		probably null	Het
Nav2	T	A	7: 49,597,231	I2168N	probably damaging	Het
Nlrp10	T	A	7: 108,924,341	D644V	possibly damaging	Het
Olfr1472	T	C	19: 13,454,471	I15M	probably benign	Het
Olfr148	A	G	9: 39,613,957	Y130C	possibly damaging	Het
Olfr15	T	C	16: 3,839,570	L199P	probably damaging	Het
Oplah	C	T	15: 76,302,710	R635H	probably damaging	Het
Peli1	A	G	11: 21,147,115		probably null	Het
Pfkfb1	A	T	X: 150,622,188	D208V	possibly damaging	Het
Pld5	T	G	1: 175,993,875	T242P	probably damaging	Het
Rbm5	A	G	9: 107,750,483	S420P	probably benign	Het
Rhag	A	T	17: 40,831,653	I250F	probably damaging	Het
Rnase4	A	G	14: 51,105,005	K62R	probably benign	Het
Scaf4	C	T	16: 90,260,215	V83I	unknown	Het
Slc24a2	A	G	4: 87,227,205	V204A	probably damaging	Het
Slc5a8	G	T	10: 88,911,413	L409F	probably damaging	Het
Spns3	A	T	11: 72,538,361	V199E	probably damaging	Het
Sspo	A	G	6: 48,478,293	T3030A	probably benign	Het
Sstr2	A	C	11: 113,624,656	T134P	probably damaging	Het
Stk39	G	T	2: 68,220,920	T527K	probably benign	Het
Sult2a1	T	A	7: 13,801,547	T194S	probably benign	Het
Tamm41	AGGG	AGG	6: 115,012,359		probably benign	Het
Trav7-3	A	G	14: 53,443,746	T82A	probably benign	Het
Umodl1	G	A	17: 30,959,367	V106I	probably damaging	Het
Vmn2r85	A	C	10: 130,418,705	C703W	probably damaging	Het
Vmn2r92	G	A	17: 18,184,261	V556M	possibly damaging	Het
Zfp292	T	C	4: 34,806,079	I2322V	probably benign	Het
Zfp644	T	C	5: 106,618,276	E93G	probably damaging	Het
Zfp81	C	T	17: 33,334,916	C308Y	probably damaging	Het

Other mutations in Ap1b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01759:Ap1b1	APN	11	5019433	missense	probably damaging	1.00
IGL01843:Ap1b1	APN	11	5039169	missense	probably damaging	1.00
IGL01981:Ap1b1	APN	11	5019336	missense	possibly damaging	0.84
IGL02055:Ap1b1	APN	11	5024452	nonsense	probably null
IGL02318:Ap1b1	APN	11	5019294	missense	probably benign	0.14
IGL02505:Ap1b1	APN	11	5031700	missense	probably benign	0.11
IGL02824:Ap1b1	APN	11	5033738	missense	possibly damaging	0.47
IGL02825:Ap1b1	APN	11	5033738	missense	possibly damaging	0.47
IGL02963:Ap1b1	APN	11	5033738	missense	possibly damaging	0.47
PIT4142001:Ap1b1	UTSW	11	5040360	missense	probably damaging	1.00
R0321:Ap1b1	UTSW	11	5032464	missense	probably benign
R0477:Ap1b1	UTSW	11	5031787	missense	probably benign	0.13
R0622:Ap1b1	UTSW	11	5037707	missense	probably damaging	0.96
R0831:Ap1b1	UTSW	11	5023092	splice site	probably benign
R1502:Ap1b1	UTSW	11	5040290	missense	probably benign
R1529:Ap1b1	UTSW	11	5039547	missense	probably damaging	1.00
R2110:Ap1b1	UTSW	11	5015613	missense	probably damaging	0.99
R2112:Ap1b1	UTSW	11	5015613	missense	probably damaging	0.99
R2186:Ap1b1	UTSW	11	5015737	missense	possibly damaging	0.84
R2906:Ap1b1	UTSW	11	5031641	missense	probably damaging	1.00
R2907:Ap1b1	UTSW	11	5031641	missense	probably damaging	1.00
R2908:Ap1b1	UTSW	11	5031641	missense	probably damaging	1.00
R3154:Ap1b1	UTSW	11	5023135	missense	possibly damaging	0.95
R3611:Ap1b1	UTSW	11	5024427	missense	possibly damaging	0.87
R3805:Ap1b1	UTSW	11	5033225	splice site	probably null
R4660:Ap1b1	UTSW	11	5016760	missense	probably damaging	1.00
R4710:Ap1b1	UTSW	11	5031664	missense	probably damaging	0.97
R4826:Ap1b1	UTSW	11	5018043	missense	probably benign	0.11
R4914:Ap1b1	UTSW	11	5024400	missense	possibly damaging	0.73
R5086:Ap1b1	UTSW	11	5018020	missense	possibly damaging	0.83
R5249:Ap1b1	UTSW	11	5026364	missense	probably damaging	0.97
R6014:Ap1b1	UTSW	11	5019364	missense	possibly damaging	0.55
R6268:Ap1b1	UTSW	11	5019493	missense	probably damaging	1.00
R6388:Ap1b1	UTSW	11	5026319	missense	probably damaging	1.00
R6765:Ap1b1	UTSW	11	5019427	missense	probably damaging	1.00
R6913:Ap1b1	UTSW	11	5012972	missense	possibly damaging	0.84
R7012:Ap1b1	UTSW	11	5030963	missense	probably damaging	1.00
R7107:Ap1b1	UTSW	11	5039558	missense	probably benign	0.02
R8291:Ap1b1	UTSW	11	5018027	missense	probably damaging	1.00
R9075:Ap1b1	UTSW	11	5025597	missense	possibly damaging	0.93
R9090:Ap1b1	UTSW	11	5023174	missense	probably damaging	1.00
R9271:Ap1b1	UTSW	11	5023174	missense	probably damaging	1.00
R9297:Ap1b1	UTSW	11	5040157	missense	probably benign	0.05
R9318:Ap1b1	UTSW	11	5040157	missense	probably benign	0.05
R9560:Ap1b1	UTSW	11	5026363	missense	probably benign	0.38
X0018:Ap1b1	UTSW	11	5009581	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGTGGTTTGAAAGCCAAC -3'
(R):5'- TTGTGGTAGACAGAGGCCAG -3'

Sequencing Primer
(F):5'- TAGGCAGAGCTCTGAGTTCAAAGTC -3'
(R):5'- CAGCGTGCCAATGTAGCAG -3'

Posted On

2015-06-10