Mutagenetix > Incidental Mutation

Incidental Mutation 'R4207:Abca8b'

318982

Institutional Source

Beutler Lab

Gene Symbol

Abca8b

Ensembl Gene

ENSMUSG00000020620

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 8b

Synonyms

Abca8

MMRRC Submission

041036-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4207 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

109932190-109995845 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 109981725 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 17 (Q17*)

Ref Sequence

ENSEMBL: ENSMUSP00000102280 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020948] [ENSMUST00000106669]

AlphaFold

Q8K440

Predicted Effect

probably null
Transcript: ENSMUST00000020948
AA Change: Q17*

SMART Domains

Protein: ENSMUSP00000020948
Gene: ENSMUSG00000020620
AA Change: Q17*

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	28	417	3.9e-28	PFAM
AAA	507	691	6.36e-10	SMART
Pfam:ABC2_membrane_3	859	1215	1e-10	PFAM
low complexity region	1246	1255	N/A	INTRINSIC
AAA	1313	1492	6.17e-8	SMART
low complexity region	1597	1607	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000106669
AA Change: Q17*

SMART Domains

Protein: ENSMUSP00000102280
Gene: ENSMUSG00000020620
AA Change: Q17*

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	28	344	2.6e-16	PFAM
AAA	445	629	6.36e-10	SMART
transmembrane domain	798	815	N/A	INTRINSIC
transmembrane domain	1001	1023	N/A	INTRINSIC
transmembrane domain	1038	1060	N/A	INTRINSIC
transmembrane domain	1072	1091	N/A	INTRINSIC
transmembrane domain	1101	1123	N/A	INTRINSIC
transmembrane domain	1136	1158	N/A	INTRINSIC
low complexity region	1184	1193	N/A	INTRINSIC
AAA	1251	1430	6.17e-8	SMART
low complexity region	1535	1545	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.5%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. The encoded protein may regulate lipid metabolism and be involved in the formation and maintenance of myelin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acap2	T	A	16: 31,119,427	N293I	probably damaging	Het
Adgrg4	G	A	X: 56,918,749	V1893I	possibly damaging	Het
Aff1	T	C	5: 103,818,988		probably null	Het
Ap1b1	A	G	11: 5,031,637	D515G	probably damaging	Het
Brk1	T	C	6: 113,615,844	Y63H	possibly damaging	Het
Cand1	T	C	10: 119,211,845	D580G	probably damaging	Het
Casp4	A	G	9: 5,328,451	D311G	probably benign	Het
Crygs	C	T	16: 22,805,551	G102D	possibly damaging	Het
Ctnnd2	G	T	15: 30,972,827	V1033F	probably damaging	Het
Dhx29	G	T	13: 112,927,949	A53S	probably benign	Het
Dis3	T	G	14: 99,095,316	I227L	probably benign	Het
Efhc2	T	C	X: 17,230,550	N186S	possibly damaging	Het
Efl1	T	C	7: 82,750,816	V592A	probably damaging	Het
Elovl7	A	T	13: 108,282,506	Q224L	possibly damaging	Het
Fcgr3	T	A	1: 171,054,075	K160N	probably benign	Het
Flg	A	G	3: 93,279,862	Y207C	probably benign	Het
Fmn2	A	G	1: 174,581,955	T585A	unknown	Het
Gm7135	T	C	1: 97,469,895		noncoding transcript	Het
Gm8104	G	T	14: 43,101,634	D94Y	probably damaging	Het
Hjurp	G	C	1: 88,277,215		probably benign	Het
Ino80b	G	C	6: 83,122,333	P178R	probably damaging	Het
Kbtbd4	T	C	2: 90,909,755	F495L	probably damaging	Het
Lingo2	T	C	4: 35,709,810	I57V	probably benign	Het
Me2	T	C	18: 73,791,085	K352R	probably benign	Het
Mthfsd	A	G	8: 121,105,626	V133A	probably damaging	Het
Nav2	T	A	7: 49,572,298		probably null	Het
Nav2	T	A	7: 49,597,231	I2168N	probably damaging	Het
Nlrp10	T	A	7: 108,924,341	D644V	possibly damaging	Het
Olfr1472	T	C	19: 13,454,471	I15M	probably benign	Het
Olfr148	A	G	9: 39,613,957	Y130C	possibly damaging	Het
Olfr15	T	C	16: 3,839,570	L199P	probably damaging	Het
Oplah	C	T	15: 76,302,710	R635H	probably damaging	Het
Peli1	A	G	11: 21,147,115		probably null	Het
Pfkfb1	A	T	X: 150,622,188	D208V	possibly damaging	Het
Pld5	T	G	1: 175,993,875	T242P	probably damaging	Het
Rbm5	A	G	9: 107,750,483	S420P	probably benign	Het
Rhag	A	T	17: 40,831,653	I250F	probably damaging	Het
Rnase4	A	G	14: 51,105,005	K62R	probably benign	Het
Scaf4	C	T	16: 90,260,215	V83I	unknown	Het
Slc24a2	A	G	4: 87,227,205	V204A	probably damaging	Het
Slc5a8	G	T	10: 88,911,413	L409F	probably damaging	Het
Spns3	A	T	11: 72,538,361	V199E	probably damaging	Het
Sspo	A	G	6: 48,478,293	T3030A	probably benign	Het
Sstr2	A	C	11: 113,624,656	T134P	probably damaging	Het
Stk39	G	T	2: 68,220,920	T527K	probably benign	Het
Sult2a1	T	A	7: 13,801,547	T194S	probably benign	Het
Tamm41	AGGG	AGG	6: 115,012,359		probably benign	Het
Trav7-3	A	G	14: 53,443,746	T82A	probably benign	Het
Umodl1	G	A	17: 30,959,367	V106I	probably damaging	Het
Vmn2r85	A	C	10: 130,418,705	C703W	probably damaging	Het
Vmn2r92	G	A	17: 18,184,261	V556M	possibly damaging	Het
Zfp292	T	C	4: 34,806,079	I2322V	probably benign	Het
Zfp644	T	C	5: 106,618,276	E93G	probably damaging	Het
Zfp81	C	T	17: 33,334,916	C308Y	probably damaging	Het

Other mutations in Abca8b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00862:Abca8b	APN	11	109953548	missense	possibly damaging	0.66
IGL00952:Abca8b	APN	11	109969060	critical splice donor site	probably null
IGL01141:Abca8b	APN	11	109937730	missense	probably damaging	1.00
IGL01523:Abca8b	APN	11	109976494	missense	probably damaging	1.00
IGL01633:Abca8b	APN	11	109936754	missense	probably damaging	0.99
IGL01862:Abca8b	APN	11	109947171	nonsense	probably null
IGL01963:Abca8b	APN	11	109971763	missense	probably damaging	0.99
IGL02169:Abca8b	APN	11	109952582	missense	probably damaging	0.98
IGL02536:Abca8b	APN	11	109981748	missense	probably benign	0.02
IGL02658:Abca8b	APN	11	109952560	missense	probably benign
IGL02828:Abca8b	APN	11	109980894	missense	probably damaging	0.99
IGL03118:Abca8b	APN	11	109947181	missense	possibly damaging	0.66
IGL03302:Abca8b	APN	11	109967750	missense	possibly damaging	0.80
IGL03325:Abca8b	APN	11	109953596	missense	possibly damaging	0.94
R0057:Abca8b	UTSW	11	109941559	missense	possibly damaging	0.91
R0131:Abca8b	UTSW	11	109942289	missense	possibly damaging	0.46
R0226:Abca8b	UTSW	11	109957018	splice site	probably null
R0426:Abca8b	UTSW	11	109955027	splice site	probably benign
R0432:Abca8b	UTSW	11	109980015	missense	possibly damaging	0.94
R0512:Abca8b	UTSW	11	109950650	missense	probably benign	0.32
R0589:Abca8b	UTSW	11	109942268	missense	probably damaging	0.96
R0690:Abca8b	UTSW	11	109969808	splice site	probably benign
R1263:Abca8b	UTSW	11	109941607	missense	possibly damaging	0.66
R1371:Abca8b	UTSW	11	109953553	missense	probably damaging	0.99
R1497:Abca8b	UTSW	11	109973821	splice site	probably benign
R1502:Abca8b	UTSW	11	109974645	missense	probably damaging	1.00
R1517:Abca8b	UTSW	11	109971814	missense	possibly damaging	0.66
R1543:Abca8b	UTSW	11	109974674	missense	probably damaging	0.98
R1618:Abca8b	UTSW	11	109949888	splice site	probably benign
R1625:Abca8b	UTSW	11	109967121	missense	probably benign	0.11
R1753:Abca8b	UTSW	11	109973716	missense	probably benign	0.00
R1819:Abca8b	UTSW	11	109981056	critical splice acceptor site	probably null
R1822:Abca8b	UTSW	11	109957075	missense	possibly damaging	0.92
R1829:Abca8b	UTSW	11	109942341	missense	probably damaging	0.97
R1873:Abca8b	UTSW	11	109979955	missense	probably benign	0.01
R1899:Abca8b	UTSW	11	109937918	missense	possibly damaging	0.92
R1908:Abca8b	UTSW	11	109957098	missense	possibly damaging	0.92
R1962:Abca8b	UTSW	11	109979898	missense	probably benign	0.00
R1984:Abca8b	UTSW	11	109977841	missense	probably damaging	1.00
R2035:Abca8b	UTSW	11	109957106	missense	possibly damaging	0.94
R2092:Abca8b	UTSW	11	109966708	missense	possibly damaging	0.63
R2100:Abca8b	UTSW	11	109937782	missense	probably damaging	1.00
R2267:Abca8b	UTSW	11	109955148	missense	probably benign	0.03
R2871:Abca8b	UTSW	11	109955176	missense	possibly damaging	0.83
R2871:Abca8b	UTSW	11	109955176	missense	possibly damaging	0.83
R2872:Abca8b	UTSW	11	109955176	missense	possibly damaging	0.83
R2872:Abca8b	UTSW	11	109955176	missense	possibly damaging	0.83
R2873:Abca8b	UTSW	11	109955176	missense	possibly damaging	0.83
R3711:Abca8b	UTSW	11	109946255	missense	possibly damaging	0.46
R3937:Abca8b	UTSW	11	109974567	missense	probably benign	0.01
R4052:Abca8b	UTSW	11	109981725	nonsense	probably null
R4060:Abca8b	UTSW	11	109957201	missense	probably benign	0.04
R4208:Abca8b	UTSW	11	109981725	nonsense	probably null
R4354:Abca8b	UTSW	11	109971692	missense	probably benign	0.27
R4399:Abca8b	UTSW	11	109936385	missense	possibly damaging	0.66
R4456:Abca8b	UTSW	11	109942245	missense	probably benign	0.27
R4509:Abca8b	UTSW	11	109966755	missense	probably damaging	1.00
R4672:Abca8b	UTSW	11	109936448	missense	possibly damaging	0.81
R4868:Abca8b	UTSW	11	109974512	missense	probably benign	0.05
R5002:Abca8b	UTSW	11	109961797	missense	probably damaging	0.96
R5007:Abca8b	UTSW	11	109936764	missense	probably damaging	1.00
R5014:Abca8b	UTSW	11	109950131	missense	probably damaging	0.98
R5023:Abca8b	UTSW	11	109974988	critical splice donor site	probably null
R5091:Abca8b	UTSW	11	109936384	missense	possibly damaging	0.92
R5098:Abca8b	UTSW	11	109957118	missense	probably benign	0.05
R5117:Abca8b	UTSW	11	109966803	missense	probably damaging	1.00
R5234:Abca8b	UTSW	11	109976594	missense	possibly damaging	0.90
R5302:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5307:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5487:Abca8b	UTSW	11	109953514	missense	probably damaging	0.99
R5512:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5564:Abca8b	UTSW	11	109934581	missense	probably benign	0.08
R5610:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5677:Abca8b	UTSW	11	109940861	missense	probably damaging	1.00
R5723:Abca8b	UTSW	11	109953619	missense	possibly damaging	0.90
R5827:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5829:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5848:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5849:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5850:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5854:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5982:Abca8b	UTSW	11	109953597	missense	possibly damaging	0.80
R5994:Abca8b	UTSW	11	109949766	splice site	probably null
R6035:Abca8b	UTSW	11	109971860	splice site	probably null
R6035:Abca8b	UTSW	11	109971860	splice site	probably null
R6050:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R6145:Abca8b	UTSW	11	109973808	missense	probably benign	0.03
R6223:Abca8b	UTSW	11	109977846	missense	probably benign	0.00
R6349:Abca8b	UTSW	11	109934718	splice site	probably null
R7002:Abca8b	UTSW	11	109941564	missense	probably damaging	1.00
R7050:Abca8b	UTSW	11	109973718	missense	possibly damaging	0.90
R7107:Abca8b	UTSW	11	109976473	missense	probably damaging	0.98
R7158:Abca8b	UTSW	11	109934589	missense	probably damaging	1.00
R7170:Abca8b	UTSW	11	109945828	missense	probably benign	0.09
R7197:Abca8b	UTSW	11	109945822	nonsense	probably null
R7220:Abca8b	UTSW	11	109981717	missense	probably damaging	1.00
R7512:Abca8b	UTSW	11	109938449	missense	probably benign	0.01
R7590:Abca8b	UTSW	11	109938515	missense	probably damaging	0.97
R7658:Abca8b	UTSW	11	109935717	missense	probably benign	0.00
R7739:Abca8b	UTSW	11	109974591	missense	probably benign	0.05
R7797:Abca8b	UTSW	11	109971683	critical splice donor site	probably null
R7934:Abca8b	UTSW	11	109975039	missense	possibly damaging	0.75
R8074:Abca8b	UTSW	11	109938494	missense	probably benign
R8302:Abca8b	UTSW	11	109962580	critical splice donor site	probably null
R8341:Abca8b	UTSW	11	109955050	missense	probably damaging	1.00
R8486:Abca8b	UTSW	11	109967111	missense	possibly damaging	0.83
R8748:Abca8b	UTSW	11	109945771	missense	probably damaging	1.00
R8924:Abca8b	UTSW	11	109947177	missense	probably benign	0.00
R9002:Abca8b	UTSW	11	109952630	missense	probably benign	0.02
R9032:Abca8b	UTSW	11	109957247	missense	probably benign	0.04
R9099:Abca8b	UTSW	11	109980882	missense	probably damaging	1.00
R9124:Abca8b	UTSW	11	109937767	missense	probably damaging	0.97
R9178:Abca8b	UTSW	11	109950111	missense	probably benign	0.00
R9188:Abca8b	UTSW	11	109981735	nonsense	probably null
R9277:Abca8b	UTSW	11	109976521	missense	probably damaging	0.99
R9340:Abca8b	UTSW	11	109950113	missense	probably benign	0.43
R9371:Abca8b	UTSW	11	109967672	missense	probably damaging	1.00
R9382:Abca8b	UTSW	11	109979885	missense	probably benign
R9450:Abca8b	UTSW	11	109969104	missense	probably damaging	0.98
R9462:Abca8b	UTSW	11	109953607	missense
R9712:Abca8b	UTSW	11	109942337	missense	probably benign	0.30
Z1088:Abca8b	UTSW	11	109976482	missense	probably benign	0.09
Z1176:Abca8b	UTSW	11	109961908	missense	possibly damaging	0.52
Z1176:Abca8b	UTSW	11	109974644	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- GCAGAATGGTGGTCATCTGAGG -3'
(R):5'- TTTGGGGAAGAGATAAGCGCTC -3'

Sequencing Primer
(F):5'- GCTTTGGTACTTAGAGACCCTAGC -3'
(R):5'- CATTTAGATCAGTGACCTCAGCAGG -3'

Posted On

2015-06-10