Mutagenetix > Incidental Mutation

Incidental Mutation 'R4207:Dis3'

318990

Institutional Source

Beutler Lab

Gene Symbol

Dis3

Ensembl Gene

ENSMUSG00000033166

Gene Name

DIS3 homolog, exosome endoribonuclease and 3'-5' exoribonuclease

Synonyms

2810028N01Rik

MMRRC Submission

041036-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4207 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

99075206-99099770 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 99095316 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 227 (I227L)

Ref Sequence

ENSEMBL: ENSMUSP00000041906 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022650] [ENSMUST00000042471] [ENSMUST00000227022] [ENSMUST00000228643]

AlphaFold

Q9CSH3

Predicted Effect

probably benign
Transcript: ENSMUST00000022650

SMART Domains

Protein: ENSMUSP00000022650
Gene: ENSMUSG00000022064

Domain	Start	End	E-Value	Type
low complexity region	14	26	N/A	INTRINSIC
coiled coil region	58	165	N/A	INTRINSIC
coiled coil region	200	364	N/A	INTRINSIC
coiled coil region	396	444	N/A	INTRINSIC
coiled coil region	474	553	N/A	INTRINSIC
coiled coil region	586	679	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000042471
AA Change: I227L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000041906
Gene: ENSMUSG00000033166
AA Change: I227L

Domain	Start	End	E-Value	Type
low complexity region	30	47	N/A	INTRINSIC
PINc	64	182	2.8e-24	SMART
low complexity region	425	436	N/A	INTRINSIC
RNB	467	797	5.56e-141	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227001

Predicted Effect

probably benign
Transcript: ENSMUST00000227022

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228246

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228279

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228354

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228449

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228598

Predicted Effect

probably benign
Transcript: ENSMUST00000228643
AA Change: I227L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Meta Mutation Damage Score

0.0591

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.5%

Validation Efficiency

100% (60/60)

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	G	A	11: 109,981,725	Q17*	probably null	Het
Acap2	T	A	16: 31,119,427	N293I	probably damaging	Het
Adgrg4	G	A	X: 56,918,749	V1893I	possibly damaging	Het
Aff1	T	C	5: 103,818,988		probably null	Het
Ap1b1	A	G	11: 5,031,637	D515G	probably damaging	Het
Brk1	T	C	6: 113,615,844	Y63H	possibly damaging	Het
Cand1	T	C	10: 119,211,845	D580G	probably damaging	Het
Casp4	A	G	9: 5,328,451	D311G	probably benign	Het
Crygs	C	T	16: 22,805,551	G102D	possibly damaging	Het
Ctnnd2	G	T	15: 30,972,827	V1033F	probably damaging	Het
Dhx29	G	T	13: 112,927,949	A53S	probably benign	Het
Efhc2	T	C	X: 17,230,550	N186S	possibly damaging	Het
Efl1	T	C	7: 82,750,816	V592A	probably damaging	Het
Elovl7	A	T	13: 108,282,506	Q224L	possibly damaging	Het
Fcgr3	T	A	1: 171,054,075	K160N	probably benign	Het
Flg	A	G	3: 93,279,862	Y207C	probably benign	Het
Fmn2	A	G	1: 174,581,955	T585A	unknown	Het
Gm7135	T	C	1: 97,469,895		noncoding transcript	Het
Gm8104	G	T	14: 43,101,634	D94Y	probably damaging	Het
Hjurp	G	C	1: 88,277,215		probably benign	Het
Ino80b	G	C	6: 83,122,333	P178R	probably damaging	Het
Kbtbd4	T	C	2: 90,909,755	F495L	probably damaging	Het
Lingo2	T	C	4: 35,709,810	I57V	probably benign	Het
Me2	T	C	18: 73,791,085	K352R	probably benign	Het
Mthfsd	A	G	8: 121,105,626	V133A	probably damaging	Het
Nav2	T	A	7: 49,572,298		probably null	Het
Nav2	T	A	7: 49,597,231	I2168N	probably damaging	Het
Nlrp10	T	A	7: 108,924,341	D644V	possibly damaging	Het
Olfr1472	T	C	19: 13,454,471	I15M	probably benign	Het
Olfr148	A	G	9: 39,613,957	Y130C	possibly damaging	Het
Olfr15	T	C	16: 3,839,570	L199P	probably damaging	Het
Oplah	C	T	15: 76,302,710	R635H	probably damaging	Het
Peli1	A	G	11: 21,147,115		probably null	Het
Pfkfb1	A	T	X: 150,622,188	D208V	possibly damaging	Het
Pld5	T	G	1: 175,993,875	T242P	probably damaging	Het
Rbm5	A	G	9: 107,750,483	S420P	probably benign	Het
Rhag	A	T	17: 40,831,653	I250F	probably damaging	Het
Rnase4	A	G	14: 51,105,005	K62R	probably benign	Het
Scaf4	C	T	16: 90,260,215	V83I	unknown	Het
Slc24a2	A	G	4: 87,227,205	V204A	probably damaging	Het
Slc5a8	G	T	10: 88,911,413	L409F	probably damaging	Het
Spns3	A	T	11: 72,538,361	V199E	probably damaging	Het
Sspo	A	G	6: 48,478,293	T3030A	probably benign	Het
Sstr2	A	C	11: 113,624,656	T134P	probably damaging	Het
Stk39	G	T	2: 68,220,920	T527K	probably benign	Het
Sult2a1	T	A	7: 13,801,547	T194S	probably benign	Het
Tamm41	AGGG	AGG	6: 115,012,359		probably benign	Het
Trav7-3	A	G	14: 53,443,746	T82A	probably benign	Het
Umodl1	G	A	17: 30,959,367	V106I	probably damaging	Het
Vmn2r85	A	C	10: 130,418,705	C703W	probably damaging	Het
Vmn2r92	G	A	17: 18,184,261	V556M	possibly damaging	Het
Zfp292	T	C	4: 34,806,079	I2322V	probably benign	Het
Zfp644	T	C	5: 106,618,276	E93G	probably damaging	Het
Zfp81	C	T	17: 33,334,916	C308Y	probably damaging	Het

Other mutations in Dis3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00492:Dis3	APN	14	99082674	missense	probably damaging	1.00
IGL00821:Dis3	APN	14	99091486	missense	probably benign	0.00
IGL00975:Dis3	APN	14	99079234	missense	probably damaging	1.00
IGL01536:Dis3	APN	14	99079423	missense	probably damaging	1.00
IGL01538:Dis3	APN	14	99097745	missense	probably benign	0.00
IGL02143:Dis3	APN	14	99091318	splice site	probably benign
IGL02270:Dis3	APN	14	99078354	missense	probably benign	0.01
IGL02354:Dis3	APN	14	99079712	nonsense	probably null
IGL02361:Dis3	APN	14	99079712	nonsense	probably null
IGL02650:Dis3	APN	14	99098785	missense	probably benign	0.00
IGL03053:Dis3	APN	14	99098734	missense	probably benign	0.00
IGL03057:Dis3	APN	14	99089990	missense	possibly damaging	0.95
IGL03389:Dis3	APN	14	99095347	splice site	probably benign
R0415:Dis3	UTSW	14	99087456	missense	probably damaging	1.00
R0504:Dis3	UTSW	14	99081390	splice site	probably benign
R1535:Dis3	UTSW	14	99079426	missense	probably damaging	1.00
R1756:Dis3	UTSW	14	99086103	missense	probably damaging	1.00
R1767:Dis3	UTSW	14	99084142	missense	probably damaging	1.00
R1883:Dis3	UTSW	14	99091469	missense	probably benign	0.21
R1938:Dis3	UTSW	14	99097590	missense	probably benign	0.09
R2056:Dis3	UTSW	14	99098815	missense	possibly damaging	0.90
R2133:Dis3	UTSW	14	99079877	missense	probably benign	0.18
R2448:Dis3	UTSW	14	99087412	missense	probably damaging	0.99
R3407:Dis3	UTSW	14	99098776	missense	probably benign	0.15
R4052:Dis3	UTSW	14	99095316	missense	probably benign	0.00
R4208:Dis3	UTSW	14	99095316	missense	probably benign	0.00
R4465:Dis3	UTSW	14	99084114	missense	possibly damaging	0.88
R4612:Dis3	UTSW	14	99091435	missense	probably benign	0.07
R4859:Dis3	UTSW	14	99087790	missense	probably damaging	1.00
R4932:Dis3	UTSW	14	99088904	missense	probably damaging	1.00
R5273:Dis3	UTSW	14	99098806	missense	probably benign	0.32
R5335:Dis3	UTSW	14	99097653	missense	possibly damaging	0.72
R5409:Dis3	UTSW	14	99085932	missense	possibly damaging	0.95
R5802:Dis3	UTSW	14	99099664	missense	probably damaging	1.00
R6156:Dis3	UTSW	14	99098779	missense	probably benign	0.10
R6309:Dis3	UTSW	14	99085922	missense	probably benign	0.00
R7275:Dis3	UTSW	14	99087489	missense	probably damaging	1.00
R7511:Dis3	UTSW	14	99099606	missense	possibly damaging	0.94
R7535:Dis3	UTSW	14	99089979	missense	probably benign	0.15
R7794:Dis3	UTSW	14	99098797	missense	probably benign	0.04
R8013:Dis3	UTSW	14	99077399	missense	possibly damaging	0.50
R8014:Dis3	UTSW	14	99077399	missense	possibly damaging	0.50
R8077:Dis3	UTSW	14	99090035	missense	probably benign	0.03
R8957:Dis3	UTSW	14	99099591	missense	probably damaging	1.00
R9072:Dis3	UTSW	14	99095211	missense	probably benign	0.44
R9073:Dis3	UTSW	14	99095211	missense	probably benign	0.44
R9345:Dis3	UTSW	14	99081378	missense	probably damaging	1.00
R9542:Dis3	UTSW	14	99079539	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGCTATTGCTGGGAACAAAGAGAC -3'
(R):5'- ACCACCTTCTTTACAGCGAG -3'

Sequencing Primer
(F):5'- GGTGGAAAAGCCTGCAGC -3'
(R):5'- GCGAGTTATTTTAGATACAAGTGGTC -3'

Posted On

2015-06-10