Mutagenetix > Incidental Mutation

Incidental Mutation 'R4207:Ctnnd2'

318991

Institutional Source

Beutler Lab

Gene Symbol

Ctnnd2

Ensembl Gene

ENSMUSG00000022240

Gene Name

catenin (cadherin associated protein), delta 2

Synonyms

Catnd2, neurojugin, Nprap

MMRRC Submission

041036-MU

Accession Numbers

NCBI RefSeq: NM_008729.2; MGI:1195966

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4207 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30172593-31029341 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 30972827 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Phenylalanine at position 1033 (V1033F)

Ref Sequence

ENSEMBL: ENSMUSP00000080427 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081728] [ENSMUST00000226119]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000081728
AA Change: V1033F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000080427
Gene: ENSMUSG00000022240
AA Change: V1033F

Domain	Start	End	E-Value	Type
coiled coil region	50	84	N/A	INTRINSIC
low complexity region	87	97	N/A	INTRINSIC
low complexity region	148	159	N/A	INTRINSIC
low complexity region	216	230	N/A	INTRINSIC
low complexity region	238	257	N/A	INTRINSIC
ARM	577	617	1.85e-8	SMART
ARM	621	662	1.15e-9	SMART
ARM	663	720	1.51e1	SMART
ARM	722	769	2.74e1	SMART
ARM	830	871	4.88e0	SMART
ARM	902	942	2.76e-7	SMART
low complexity region	964	973	N/A	INTRINSIC
ARM	995	1039	5.64e-4	SMART
low complexity region	1086	1099	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000226119
AA Change: V1008F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

Meta Mutation Damage Score

0.5416

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.5%

Validation Efficiency

100% (60/60)

MGI Phenotype

Strain: 3056606
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adhesive junction associated protein of the armadillo/beta-catenin superfamily and is implicated in brain and eye development and cancer formation. The protein encoded by this gene promotes the disruption of E-cadherin based adherens junction to favor cell spreading upon stimulation by hepatocyte growth factor. This gene is overexpressed in prostate adenocarcinomas and is associated with decreased expression of tumor suppressor E-cadherin in this tissue. This gene resides in a region of the short arm of chromosome 5 that is deleted in Cri du Chat syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a reporter allele exhibit abnormal conditioning, spatial learning and coordination behaviors and abnormal long term potentiation. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	G	A	11: 109,981,725	Q17*	probably null	Het
Acap2	T	A	16: 31,119,427	N293I	probably damaging	Het
Adgrg4	G	A	X: 56,918,749	V1893I	possibly damaging	Het
Aff1	T	C	5: 103,818,988		probably null	Het
Ap1b1	A	G	11: 5,031,637	D515G	probably damaging	Het
Brk1	T	C	6: 113,615,844	Y63H	possibly damaging	Het
Cand1	T	C	10: 119,211,845	D580G	probably damaging	Het
Casp4	A	G	9: 5,328,451	D311G	probably benign	Het
Crygs	C	T	16: 22,805,551	G102D	possibly damaging	Het
Dhx29	G	T	13: 112,927,949	A53S	probably benign	Het
Dis3	T	G	14: 99,095,316	I227L	probably benign	Het
Efhc2	T	C	X: 17,230,550	N186S	possibly damaging	Het
Efl1	T	C	7: 82,750,816	V592A	probably damaging	Het
Elovl7	A	T	13: 108,282,506	Q224L	possibly damaging	Het
Fcgr3	T	A	1: 171,054,075	K160N	probably benign	Het
Flg	A	G	3: 93,279,862	Y207C	probably benign	Het
Fmn2	A	G	1: 174,581,955	T585A	unknown	Het
Gm7135	T	C	1: 97,469,895		noncoding transcript	Het
Gm8104	G	T	14: 43,101,634	D94Y	probably damaging	Het
Hjurp	G	C	1: 88,277,215		probably benign	Het
Ino80b	G	C	6: 83,122,333	P178R	probably damaging	Het
Kbtbd4	T	C	2: 90,909,755	F495L	probably damaging	Het
Lingo2	T	C	4: 35,709,810	I57V	probably benign	Het
Me2	T	C	18: 73,791,085	K352R	probably benign	Het
Mthfsd	A	G	8: 121,105,626	V133A	probably damaging	Het
Nav2	T	A	7: 49,572,298		probably null	Het
Nav2	T	A	7: 49,597,231	I2168N	probably damaging	Het
Nlrp10	T	A	7: 108,924,341	D644V	possibly damaging	Het
Olfr1472	T	C	19: 13,454,471	I15M	probably benign	Het
Olfr148	A	G	9: 39,613,957	Y130C	possibly damaging	Het
Olfr15	T	C	16: 3,839,570	L199P	probably damaging	Het
Oplah	C	T	15: 76,302,710	R635H	probably damaging	Het
Peli1	A	G	11: 21,147,115		probably null	Het
Pfkfb1	A	T	X: 150,622,188	D208V	possibly damaging	Het
Pld5	T	G	1: 175,993,875	T242P	probably damaging	Het
Rbm5	A	G	9: 107,750,483	S420P	probably benign	Het
Rhag	A	T	17: 40,831,653	I250F	probably damaging	Het
Rnase4	A	G	14: 51,105,005	K62R	probably benign	Het
Scaf4	C	T	16: 90,260,215	V83I	unknown	Het
Slc24a2	A	G	4: 87,227,205	V204A	probably damaging	Het
Slc5a8	G	T	10: 88,911,413	L409F	probably damaging	Het
Spns3	A	T	11: 72,538,361	V199E	probably damaging	Het
Sspo	A	G	6: 48,478,293	T3030A	probably benign	Het
Sstr2	A	C	11: 113,624,656	T134P	probably damaging	Het
Stk39	G	T	2: 68,220,920	T527K	probably benign	Het
Sult2a1	T	A	7: 13,801,547	T194S	probably benign	Het
Tamm41	AGGG	AGG	6: 115,012,359		probably benign	Het
Trav7-3	A	G	14: 53,443,746	T82A	probably benign	Het
Umodl1	G	A	17: 30,959,367	V106I	probably damaging	Het
Vmn2r85	A	C	10: 130,418,705	C703W	probably damaging	Het
Vmn2r92	G	A	17: 18,184,261	V556M	possibly damaging	Het
Zfp292	T	C	4: 34,806,079	I2322V	probably benign	Het
Zfp644	T	C	5: 106,618,276	E93G	probably damaging	Het
Zfp81	C	T	17: 33,334,916	C308Y	probably damaging	Het

Other mutations in Ctnnd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00597:Ctnnd2	APN	15	30647141	missense	possibly damaging	0.73
IGL01612:Ctnnd2	APN	15	31005018	missense	probably damaging	1.00
IGL01923:Ctnnd2	APN	15	30480828	missense	probably damaging	0.99
IGL02183:Ctnnd2	APN	15	31020740	missense	probably damaging	1.00
IGL02186:Ctnnd2	APN	15	30480793	missense	probably damaging	0.99
IGL02226:Ctnnd2	APN	15	30847336	missense	probably benign	0.01
IGL02307:Ctnnd2	APN	15	30647211	missense	possibly damaging	0.86
IGL02407:Ctnnd2	APN	15	30966768	missense	probably damaging	1.00
IGL02474:Ctnnd2	APN	15	30669562	missense	possibly damaging	0.71
IGL02718:Ctnnd2	APN	15	31027616	missense	probably damaging	1.00
IGL03249:Ctnnd2	APN	15	30683236	missense	probably benign	0.45
IGL03328:Ctnnd2	APN	15	30921847	splice site	probably benign
carpe	UTSW	15	30905820	missense	probably damaging	1.00
diem	UTSW	15	30683347	missense	possibly damaging	0.85
P0016:Ctnnd2	UTSW	15	30966938	missense	probably benign	0.00
R0130:Ctnnd2	UTSW	15	30921913	missense	probably damaging	1.00
R0408:Ctnnd2	UTSW	15	30634677	missense	probably damaging	1.00
R0611:Ctnnd2	UTSW	15	31009084	missense	possibly damaging	0.75
R0894:Ctnnd2	UTSW	15	30332155	splice site	probably benign
R1112:Ctnnd2	UTSW	15	30921880	missense	probably damaging	1.00
R1459:Ctnnd2	UTSW	15	30847299	missense	probably damaging	1.00
R1529:Ctnnd2	UTSW	15	30887121	missense	possibly damaging	0.91
R1532:Ctnnd2	UTSW	15	30921868	missense	probably damaging	1.00
R1701:Ctnnd2	UTSW	15	30921981	missense	probably damaging	1.00
R1807:Ctnnd2	UTSW	15	30619871	missense	probably damaging	1.00
R1881:Ctnnd2	UTSW	15	31005081	splice site	probably benign
R1960:Ctnnd2	UTSW	15	30647111	missense	probably damaging	0.96
R2121:Ctnnd2	UTSW	15	30669514	missense	probably damaging	1.00
R3839:Ctnnd2	UTSW	15	31009028	splice site	probably null
R3967:Ctnnd2	UTSW	15	30646929	missense	possibly damaging	0.81
R3980:Ctnnd2	UTSW	15	30669443	missense	probably benign	0.14
R4279:Ctnnd2	UTSW	15	30905820	missense	probably damaging	1.00
R4498:Ctnnd2	UTSW	15	30619874	missense	probably damaging	1.00
R4622:Ctnnd2	UTSW	15	30887169	missense	probably benign	0.17
R4622:Ctnnd2	UTSW	15	31009113	missense	probably benign	0.00
R4860:Ctnnd2	UTSW	15	30881167	missense	probably damaging	1.00
R4860:Ctnnd2	UTSW	15	30881167	missense	probably damaging	1.00
R4979:Ctnnd2	UTSW	15	31009075	missense	probably damaging	1.00
R5086:Ctnnd2	UTSW	15	30683347	missense	possibly damaging	0.85
R5330:Ctnnd2	UTSW	15	30332115	missense	probably damaging	1.00
R5459:Ctnnd2	UTSW	15	30887188	missense	probably damaging	1.00
R5595:Ctnnd2	UTSW	15	30669543	missense	probably benign	0.07
R5809:Ctnnd2	UTSW	15	30847377	missense	probably damaging	1.00
R5987:Ctnnd2	UTSW	15	30683241	missense	probably benign
R6245:Ctnnd2	UTSW	15	30905748	missense	probably damaging	1.00
R6379:Ctnnd2	UTSW	15	30634698	missense	probably damaging	1.00
R6737:Ctnnd2	UTSW	15	30966834	nonsense	probably null
R6979:Ctnnd2	UTSW	15	30619230	missense	probably damaging	0.99
R7133:Ctnnd2	UTSW	15	30480849	missense	possibly damaging	0.47
R7179:Ctnnd2	UTSW	15	30683364	missense	possibly damaging	0.95
R7267:Ctnnd2	UTSW	15	30683355	missense	probably benign	0.13
R7275:Ctnnd2	UTSW	15	30905709	missense	possibly damaging	0.94
R7386:Ctnnd2	UTSW	15	30966768	missense	probably damaging	1.00
R7649:Ctnnd2	UTSW	15	31027484	missense	probably benign	0.11
R7814:Ctnnd2	UTSW	15	31020728	missense	probably benign	0.00
R7849:Ctnnd2	UTSW	15	31027587	missense	probably damaging	1.00
R7857:Ctnnd2	UTSW	15	30619930	missense	probably benign	0.01
R8057:Ctnnd2	UTSW	15	30847351	missense	possibly damaging	0.89
R8236:Ctnnd2	UTSW	15	30647018	missense	probably benign
R8260:Ctnnd2	UTSW	15	30634733	missense	possibly damaging	0.84
R8411:Ctnnd2	UTSW	15	30647033	missense	probably benign	0.33
R8802:Ctnnd2	UTSW	15	30966876	missense	probably damaging	1.00
R8891:Ctnnd2	UTSW	15	30619930	missense	probably benign	0.01
R8907:Ctnnd2	UTSW	15	30905727	missense	probably damaging	1.00
R8989:Ctnnd2	UTSW	15	30669514	missense	probably damaging	1.00
R9017:Ctnnd2	UTSW	15	30881170	missense	probably damaging	0.96
R9035:Ctnnd2	UTSW	15	30332016	missense	possibly damaging	0.77
R9061:Ctnnd2	UTSW	15	30806738	missense	probably damaging	1.00
R9303:Ctnnd2	UTSW	15	30966891	missense	probably damaging	0.99
R9475:Ctnnd2	UTSW	15	30881130	missense	probably damaging	1.00
Z1088:Ctnnd2	UTSW	15	30966813	missense	probably benign	0.28

Predicted Primers

PCR Primer
(F):5'- CCTTTCCAGGCATGTTGCTG -3'
(R):5'- ATAGTGAGAGCCTTCTTGGTATC -3'

Sequencing Primer
(F):5'- TCCAGGCATGTTGCTGAGAAG -3'
(R):5'- AAACTCTTGTTTCAGCTAAGGC -3'

Posted On

2015-06-10