Mutagenetix > Incidental Mutation

Incidental Mutation 'R4207:Crygs'

318994

Institutional Source

Beutler Lab

Gene Symbol

Crygs

Ensembl Gene

ENSMUSG00000033501

Gene Name

crystallin, gamma S

Synonyms

Opj

MMRRC Submission

041036-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4207 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

22805203-22811577 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 22805551 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 102 (G102D)

Ref Sequence

ENSEMBL: ENSMUSP00000043588 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040592]

AlphaFold

O35486

PDB Structure

NMR structure of murine gamma-S crystallin [SOLUTION NMR]
NMR structure of murine gamma-S crystallin [SOLUTION NMR]
NMR structure of murine gamma-S crystallin from joint refinement with SAXS data [SOLUTION NMR]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000040592
AA Change: G102D

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000043588
Gene: ENSMUSG00000033501
AA Change: G102D

Domain	Start	End	E-Value	Type
XTALbg	7	86	5.98e-40	SMART
XTALbg	95	176	6.26e-43	SMART

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.5%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Crystallins are separated into two classes: taxon-specific, or enzyme, and ubiquitous. The latter class constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. Since lens central fiber cells lose their nuclei during development, these crystallins are made and then retained throughout life, making them extremely stable proteins. Mammalian lens crystallins are divided into alpha, beta, and gamma families; beta and gamma crystallins are also considered as a superfamily. Alpha and beta families are further divided into acidic and basic groups. Seven protein regions exist in crystallins: four homologous motifs, a connecting peptide, and N- and C-terminal extensions. Gamma-crystallins are a homogeneous group of highly symmetrical, monomeric proteins typically lacking connecting peptides and terminal extensions. They are differentially regulated after early development. This gene encodes a protein initially considered to be a beta-crystallin but the encoded protein is monomeric and has greater sequence similarity to other gamma-crystallins. This gene encodes the most significant gamma-crystallin in adult eye lens tissue. Whether due to aging or mutations in specific genes, gamma-crystallins have been involved in cataract formation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene can cause cataracts and/or disrupted lens fiber cell morphology and organization. Aging mice homozygous for a knock-out allele do not develop cataracts but show focusing defects associated with inefficient clearance of cellular organelles and altered actin distribution. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	G	A	11: 109,981,725	Q17*	probably null	Het
Acap2	T	A	16: 31,119,427	N293I	probably damaging	Het
Adgrg4	G	A	X: 56,918,749	V1893I	possibly damaging	Het
Aff1	T	C	5: 103,818,988		probably null	Het
Ap1b1	A	G	11: 5,031,637	D515G	probably damaging	Het
Brk1	T	C	6: 113,615,844	Y63H	possibly damaging	Het
Cand1	T	C	10: 119,211,845	D580G	probably damaging	Het
Casp4	A	G	9: 5,328,451	D311G	probably benign	Het
Ctnnd2	G	T	15: 30,972,827	V1033F	probably damaging	Het
Dhx29	G	T	13: 112,927,949	A53S	probably benign	Het
Dis3	T	G	14: 99,095,316	I227L	probably benign	Het
Efhc2	T	C	X: 17,230,550	N186S	possibly damaging	Het
Efl1	T	C	7: 82,750,816	V592A	probably damaging	Het
Elovl7	A	T	13: 108,282,506	Q224L	possibly damaging	Het
Fcgr3	T	A	1: 171,054,075	K160N	probably benign	Het
Flg	A	G	3: 93,279,862	Y207C	probably benign	Het
Fmn2	A	G	1: 174,581,955	T585A	unknown	Het
Gm7135	T	C	1: 97,469,895		noncoding transcript	Het
Gm8104	G	T	14: 43,101,634	D94Y	probably damaging	Het
Hjurp	G	C	1: 88,277,215		probably benign	Het
Ino80b	G	C	6: 83,122,333	P178R	probably damaging	Het
Kbtbd4	T	C	2: 90,909,755	F495L	probably damaging	Het
Lingo2	T	C	4: 35,709,810	I57V	probably benign	Het
Me2	T	C	18: 73,791,085	K352R	probably benign	Het
Mthfsd	A	G	8: 121,105,626	V133A	probably damaging	Het
Nav2	T	A	7: 49,572,298		probably null	Het
Nav2	T	A	7: 49,597,231	I2168N	probably damaging	Het
Nlrp10	T	A	7: 108,924,341	D644V	possibly damaging	Het
Olfr1472	T	C	19: 13,454,471	I15M	probably benign	Het
Olfr148	A	G	9: 39,613,957	Y130C	possibly damaging	Het
Olfr15	T	C	16: 3,839,570	L199P	probably damaging	Het
Oplah	C	T	15: 76,302,710	R635H	probably damaging	Het
Peli1	A	G	11: 21,147,115		probably null	Het
Pfkfb1	A	T	X: 150,622,188	D208V	possibly damaging	Het
Pld5	T	G	1: 175,993,875	T242P	probably damaging	Het
Rbm5	A	G	9: 107,750,483	S420P	probably benign	Het
Rhag	A	T	17: 40,831,653	I250F	probably damaging	Het
Rnase4	A	G	14: 51,105,005	K62R	probably benign	Het
Scaf4	C	T	16: 90,260,215	V83I	unknown	Het
Slc24a2	A	G	4: 87,227,205	V204A	probably damaging	Het
Slc5a8	G	T	10: 88,911,413	L409F	probably damaging	Het
Spns3	A	T	11: 72,538,361	V199E	probably damaging	Het
Sspo	A	G	6: 48,478,293	T3030A	probably benign	Het
Sstr2	A	C	11: 113,624,656	T134P	probably damaging	Het
Stk39	G	T	2: 68,220,920	T527K	probably benign	Het
Sult2a1	T	A	7: 13,801,547	T194S	probably benign	Het
Tamm41	AGGG	AGG	6: 115,012,359		probably benign	Het
Trav7-3	A	G	14: 53,443,746	T82A	probably benign	Het
Umodl1	G	A	17: 30,959,367	V106I	probably damaging	Het
Vmn2r85	A	C	10: 130,418,705	C703W	probably damaging	Het
Vmn2r92	G	A	17: 18,184,261	V556M	possibly damaging	Het
Zfp292	T	C	4: 34,806,079	I2322V	probably benign	Het
Zfp644	T	C	5: 106,618,276	E93G	probably damaging	Het
Zfp81	C	T	17: 33,334,916	C308Y	probably damaging	Het

Other mutations in Crygs

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00899:Crygs	APN	16	22806562	missense	possibly damaging	0.81
R1694:Crygs	UTSW	16	22806675	splice site	probably null
R1932:Crygs	UTSW	16	22806554	missense	probably benign	0.12
R2206:Crygs	UTSW	16	22805551	missense	possibly damaging	0.93
R2207:Crygs	UTSW	16	22805551	missense	possibly damaging	0.93
R2275:Crygs	UTSW	16	22805551	missense	possibly damaging	0.93
R2298:Crygs	UTSW	16	22805551	missense	possibly damaging	0.93
R2299:Crygs	UTSW	16	22805551	missense	possibly damaging	0.93
R2300:Crygs	UTSW	16	22805551	missense	possibly damaging	0.93
R2326:Crygs	UTSW	16	22805551	missense	possibly damaging	0.93
R2329:Crygs	UTSW	16	22805551	missense	possibly damaging	0.93
R2330:Crygs	UTSW	16	22805551	missense	possibly damaging	0.93
R2331:Crygs	UTSW	16	22805551	missense	possibly damaging	0.93
R2332:Crygs	UTSW	16	22805551	missense	possibly damaging	0.93
R2857:Crygs	UTSW	16	22805551	missense	possibly damaging	0.93
R2895:Crygs	UTSW	16	22805551	missense	possibly damaging	0.93
R2896:Crygs	UTSW	16	22805551	missense	possibly damaging	0.93
R2921:Crygs	UTSW	16	22805551	missense	possibly damaging	0.93
R2922:Crygs	UTSW	16	22805551	missense	possibly damaging	0.93
R3120:Crygs	UTSW	16	22805551	missense	possibly damaging	0.93
R3196:Crygs	UTSW	16	22805551	missense	possibly damaging	0.93
R3427:Crygs	UTSW	16	22805551	missense	possibly damaging	0.93
R3609:Crygs	UTSW	16	22805551	missense	possibly damaging	0.93
R3611:Crygs	UTSW	16	22805551	missense	possibly damaging	0.93
R3625:Crygs	UTSW	16	22805551	missense	possibly damaging	0.93
R3693:Crygs	UTSW	16	22805551	missense	possibly damaging	0.93
R3694:Crygs	UTSW	16	22805551	missense	possibly damaging	0.93
R3695:Crygs	UTSW	16	22805551	missense	possibly damaging	0.93
R3870:Crygs	UTSW	16	22805551	missense	possibly damaging	0.93
R3871:Crygs	UTSW	16	22805551	missense	possibly damaging	0.93
R3876:Crygs	UTSW	16	22806512	missense	probably damaging	1.00
R4052:Crygs	UTSW	16	22805551	missense	possibly damaging	0.93
R4299:Crygs	UTSW	16	22805411	nonsense	probably null
R4630:Crygs	UTSW	16	22805518	missense	possibly damaging	0.90
R7392:Crygs	UTSW	16	22806502	missense	probably benign	0.35
R7573:Crygs	UTSW	16	22805319	makesense	probably null
R7954:Crygs	UTSW	16	22805332	missense	probably damaging	1.00
R7955:Crygs	UTSW	16	22805332	missense	probably damaging	1.00
R7957:Crygs	UTSW	16	22805332	missense	probably damaging	1.00
R8172:Crygs	UTSW	16	22806542	missense	probably damaging	1.00
R9653:Crygs	UTSW	16	22806554	missense	probably benign	0.12

Predicted Primers

PCR Primer
(F):5'- ACTCTATGGTCCCACTCCAG -3'
(R):5'- ACCAGAGTTCTGATGACCCTC -3'

Sequencing Primer
(F):5'- TCACTCCACAATGCGGCG -3'
(R):5'- TGATGACCCTCCCTTAAGGATGAG -3'

Posted On

2015-06-10