Incidental Mutation 'R4207:Scaf4'
ID 318996
Institutional Source Beutler Lab
Gene Symbol Scaf4
Ensembl Gene ENSMUSG00000022983
Gene Name SR-related CTD-associated factor 4
Synonyms Sra4, Srsf15, Sfrs15
MMRRC Submission 041036-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.637) question?
Stock # R4207 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 90022568-90081391 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 90057103 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 83 (V83I)
Ref Sequence ENSEMBL: ENSMUSP00000156174 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039280] [ENSMUST00000163419] [ENSMUST00000232371]
AlphaFold Q7TSH6
Predicted Effect unknown
Transcript: ENSMUST00000039280
AA Change: V83I
SMART Domains Protein: ENSMUSP00000044472
Gene: ENSMUSG00000022983
AA Change: V83I

DomainStartEndE-ValueType
RPR 6 136 7.8e-48 SMART
low complexity region 190 214 N/A INTRINSIC
low complexity region 272 313 N/A INTRINSIC
low complexity region 360 389 N/A INTRINSIC
low complexity region 390 418 N/A INTRINSIC
low complexity region 420 448 N/A INTRINSIC
low complexity region 496 558 N/A INTRINSIC
RRM 574 643 7.47e-14 SMART
low complexity region 719 757 N/A INTRINSIC
low complexity region 762 829 N/A INTRINSIC
low complexity region 871 886 N/A INTRINSIC
low complexity region 937 980 N/A INTRINSIC
low complexity region 983 997 N/A INTRINSIC
low complexity region 1006 1046 N/A INTRINSIC
low complexity region 1082 1096 N/A INTRINSIC
low complexity region 1111 1145 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000163419
AA Change: V83I
SMART Domains Protein: ENSMUSP00000132250
Gene: ENSMUSG00000022983
AA Change: V83I

DomainStartEndE-ValueType
RPR 6 136 7.8e-48 SMART
low complexity region 190 214 N/A INTRINSIC
low complexity region 272 313 N/A INTRINSIC
low complexity region 360 389 N/A INTRINSIC
low complexity region 390 418 N/A INTRINSIC
low complexity region 420 448 N/A INTRINSIC
low complexity region 496 554 N/A INTRINSIC
RRM 570 639 7.47e-14 SMART
low complexity region 715 753 N/A INTRINSIC
low complexity region 758 825 N/A INTRINSIC
low complexity region 845 860 N/A INTRINSIC
low complexity region 911 954 N/A INTRINSIC
low complexity region 957 971 N/A INTRINSIC
low complexity region 980 1020 N/A INTRINSIC
low complexity region 1056 1070 N/A INTRINSIC
low complexity region 1085 1119 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231776
Predicted Effect unknown
Transcript: ENSMUST00000232371
AA Change: V83I
Meta Mutation Damage Score 0.0848 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene likely encodes a member of the arginine/serine-rich splicing factor family. A similar protein in Rat appears to bind the large subunit of RNA polymerase II and provide a link between transcription and pre-mRNA splicing. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b G A 11: 109,872,551 (GRCm39) Q17* probably null Het
Acap2 T A 16: 30,938,245 (GRCm39) N293I probably damaging Het
Adgrg4 G A X: 55,964,109 (GRCm39) V1893I possibly damaging Het
Aff1 T C 5: 103,966,854 (GRCm39) probably null Het
Ap1b1 A G 11: 4,981,637 (GRCm39) D515G probably damaging Het
Brk1 T C 6: 113,592,805 (GRCm39) Y63H possibly damaging Het
Cand1 T C 10: 119,047,750 (GRCm39) D580G probably damaging Het
Casp4 A G 9: 5,328,451 (GRCm39) D311G probably benign Het
Crygs C T 16: 22,624,301 (GRCm39) G102D possibly damaging Het
Ctnnd2 G T 15: 30,972,973 (GRCm39) V1033F probably damaging Het
Dhx29 G T 13: 113,064,483 (GRCm39) A53S probably benign Het
Dis3 T G 14: 99,332,752 (GRCm39) I227L probably benign Het
Efhc2 T C X: 17,096,789 (GRCm39) N186S possibly damaging Het
Efl1 T C 7: 82,400,024 (GRCm39) V592A probably damaging Het
Elovl7 A T 13: 108,419,040 (GRCm39) Q224L possibly damaging Het
Fcgr3 T A 1: 170,881,644 (GRCm39) K160N probably benign Het
Flg A G 3: 93,187,169 (GRCm39) Y207C probably benign Het
Fmn2 A G 1: 174,409,521 (GRCm39) T585A unknown Het
Gm7135 T C 1: 97,397,620 (GRCm39) noncoding transcript Het
Gm8104 G T 14: 42,959,091 (GRCm39) D94Y probably damaging Het
Hjurp G C 1: 88,204,937 (GRCm39) probably benign Het
Ino80b G C 6: 83,099,314 (GRCm39) P178R probably damaging Het
Kbtbd4 T C 2: 90,740,099 (GRCm39) F495L probably damaging Het
Lingo2 T C 4: 35,709,810 (GRCm39) I57V probably benign Het
Me2 T C 18: 73,924,156 (GRCm39) K352R probably benign Het
Mthfsd A G 8: 121,832,365 (GRCm39) V133A probably damaging Het
Nav2 T A 7: 49,246,979 (GRCm39) I2168N probably damaging Het
Nav2 T A 7: 49,222,046 (GRCm39) probably null Het
Nlrp10 T A 7: 108,523,548 (GRCm39) D644V possibly damaging Het
Oplah C T 15: 76,186,910 (GRCm39) R635H probably damaging Het
Or10n1 A G 9: 39,525,253 (GRCm39) Y130C possibly damaging Het
Or2c1 T C 16: 3,657,434 (GRCm39) L199P probably damaging Het
Or5b117 T C 19: 13,431,835 (GRCm39) I15M probably benign Het
Peli1 A G 11: 21,097,115 (GRCm39) probably null Het
Pfkfb1 A T X: 149,405,184 (GRCm39) D208V possibly damaging Het
Pld5 T G 1: 175,821,441 (GRCm39) T242P probably damaging Het
Rbm5 A G 9: 107,627,682 (GRCm39) S420P probably benign Het
Rhag A T 17: 41,142,544 (GRCm39) I250F probably damaging Het
Rnase4 A G 14: 51,342,462 (GRCm39) K62R probably benign Het
Slc24a2 A G 4: 87,145,442 (GRCm39) V204A probably damaging Het
Slc5a8 G T 10: 88,747,275 (GRCm39) L409F probably damaging Het
Spns3 A T 11: 72,429,187 (GRCm39) V199E probably damaging Het
Sspo A G 6: 48,455,227 (GRCm39) T3030A probably benign Het
Sstr2 A C 11: 113,515,482 (GRCm39) T134P probably damaging Het
Stk39 G T 2: 68,051,264 (GRCm39) T527K probably benign Het
Sult2a1 T A 7: 13,535,472 (GRCm39) T194S probably benign Het
Tamm41 AGGG AGG 6: 114,989,320 (GRCm39) probably benign Het
Trav7-3 A G 14: 53,681,203 (GRCm39) T82A probably benign Het
Umodl1 G A 17: 31,178,341 (GRCm39) V106I probably damaging Het
Vmn2r85 A C 10: 130,254,574 (GRCm39) C703W probably damaging Het
Vmn2r92 G A 17: 18,404,523 (GRCm39) V556M possibly damaging Het
Zfp292 T C 4: 34,806,079 (GRCm39) I2322V probably benign Het
Zfp644 T C 5: 106,766,142 (GRCm39) E93G probably damaging Het
Zfp81 C T 17: 33,553,890 (GRCm39) C308Y probably damaging Het
Other mutations in Scaf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Scaf4 APN 16 90,044,169 (GRCm39) missense unknown
IGL00536:Scaf4 APN 16 90,054,250 (GRCm39) missense unknown
IGL01122:Scaf4 APN 16 90,045,518 (GRCm39) missense unknown
IGL02015:Scaf4 APN 16 90,055,734 (GRCm39) missense unknown
IGL02074:Scaf4 APN 16 90,039,808 (GRCm39) missense unknown
IGL02555:Scaf4 APN 16 90,047,193 (GRCm39) missense unknown
IGL02735:Scaf4 APN 16 90,042,403 (GRCm39) missense unknown
FR4304:Scaf4 UTSW 16 90,026,742 (GRCm39) small deletion probably benign
FR4589:Scaf4 UTSW 16 90,026,742 (GRCm39) small deletion probably benign
R0217:Scaf4 UTSW 16 90,039,570 (GRCm39) missense probably damaging 0.99
R0410:Scaf4 UTSW 16 90,057,058 (GRCm39) missense unknown
R0681:Scaf4 UTSW 16 90,046,582 (GRCm39) missense unknown
R1099:Scaf4 UTSW 16 90,059,986 (GRCm39) missense unknown
R1510:Scaf4 UTSW 16 90,042,282 (GRCm39) missense unknown
R1694:Scaf4 UTSW 16 90,026,745 (GRCm39) small deletion probably benign
R2077:Scaf4 UTSW 16 90,049,323 (GRCm39) missense unknown
R2087:Scaf4 UTSW 16 90,049,313 (GRCm39) missense unknown
R2182:Scaf4 UTSW 16 90,027,028 (GRCm39) missense probably benign 0.15
R2698:Scaf4 UTSW 16 90,041,244 (GRCm39) missense unknown
R2925:Scaf4 UTSW 16 90,047,177 (GRCm39) missense unknown
R3025:Scaf4 UTSW 16 90,048,826 (GRCm39) missense unknown
R3236:Scaf4 UTSW 16 90,057,105 (GRCm39) missense unknown
R4584:Scaf4 UTSW 16 90,026,403 (GRCm39) unclassified probably benign
R4735:Scaf4 UTSW 16 90,049,320 (GRCm39) missense unknown
R4835:Scaf4 UTSW 16 90,047,195 (GRCm39) missense unknown
R4969:Scaf4 UTSW 16 90,048,831 (GRCm39) nonsense probably null
R5174:Scaf4 UTSW 16 90,044,062 (GRCm39) missense unknown
R5568:Scaf4 UTSW 16 90,026,745 (GRCm39) small deletion probably benign
R5615:Scaf4 UTSW 16 90,048,848 (GRCm39) missense unknown
R5638:Scaf4 UTSW 16 90,041,198 (GRCm39) missense unknown
R6364:Scaf4 UTSW 16 90,057,136 (GRCm39) nonsense probably null
R6470:Scaf4 UTSW 16 90,026,526 (GRCm39) nonsense probably null
R7049:Scaf4 UTSW 16 90,057,075 (GRCm39) missense unknown
R7198:Scaf4 UTSW 16 90,049,318 (GRCm39) missense unknown
R7446:Scaf4 UTSW 16 90,055,658 (GRCm39) missense unknown
R7501:Scaf4 UTSW 16 90,026,964 (GRCm39) missense unknown
R7580:Scaf4 UTSW 16 90,026,740 (GRCm39) nonsense probably null
R7631:Scaf4 UTSW 16 90,026,445 (GRCm39) missense unknown
R8380:Scaf4 UTSW 16 90,057,133 (GRCm39) missense unknown
R8963:Scaf4 UTSW 16 90,026,745 (GRCm39) small deletion probably benign
R9149:Scaf4 UTSW 16 90,027,054 (GRCm39) missense probably damaging 0.99
R9468:Scaf4 UTSW 16 90,026,287 (GRCm39) missense unknown
R9696:Scaf4 UTSW 16 90,044,122 (GRCm39) missense unknown
R9798:Scaf4 UTSW 16 90,045,533 (GRCm39) missense unknown
X0013:Scaf4 UTSW 16 90,049,179 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- AAGTGTCAACAACGTGAACG -3'
(R):5'- GCGAGCTGATGTGTGACATAG -3'

Sequencing Primer
(F):5'- CGTGAACGTAAGCATTGTGTGAG -3'
(R):5'- GGGTCAGATTCACCTCTGGAATAC -3'
Posted On 2015-06-10