Incidental Mutation 'R4207:Umodl1'
ID318998
Institutional Source Beutler Lab
Gene Symbol Umodl1
Ensembl Gene ENSMUSG00000054134
Gene Nameuromodulin-like 1
SynonymsD17Ertd488e
MMRRC Submission 041036-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4207 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location30954679-31010708 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 30959367 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 106 (V106I)
Ref Sequence ENSEMBL: ENSMUSP00000110202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066554] [ENSMUST00000066981] [ENSMUST00000114555]
Predicted Effect probably damaging
Transcript: ENSMUST00000066554
AA Change: V106I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000067443
Gene: ENSMUSG00000054134
AA Change: V106I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000066981
AA Change: V106I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065470
Gene: ENSMUSG00000054134
AA Change: V106I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 8.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 8.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 619 632 N/A INTRINSIC
SEA 706 821 8.88e-2 SMART
EGF 818 859 4.26e0 SMART
ZP 909 1152 5.44e-25 SMART
transmembrane domain 1186 1208 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114555
AA Change: V106I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110202
Gene: ENSMUSG00000054134
AA Change: V106I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 9.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 9.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Meta Mutation Damage Score 0.0836 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b G A 11: 109,981,725 Q17* probably null Het
Acap2 T A 16: 31,119,427 N293I probably damaging Het
Adgrg4 G A X: 56,918,749 V1893I possibly damaging Het
Aff1 T C 5: 103,818,988 probably null Het
Ap1b1 A G 11: 5,031,637 D515G probably damaging Het
Brk1 T C 6: 113,615,844 Y63H possibly damaging Het
Cand1 T C 10: 119,211,845 D580G probably damaging Het
Casp4 A G 9: 5,328,451 D311G probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Ctnnd2 G T 15: 30,972,827 V1033F probably damaging Het
Dhx29 G T 13: 112,927,949 A53S probably benign Het
Dis3 T G 14: 99,095,316 I227L probably benign Het
Efhc2 T C X: 17,230,550 N186S possibly damaging Het
Efl1 T C 7: 82,750,816 V592A probably damaging Het
Elovl7 A T 13: 108,282,506 Q224L possibly damaging Het
Fcgr3 T A 1: 171,054,075 K160N probably benign Het
Flg A G 3: 93,279,862 Y207C probably benign Het
Fmn2 A G 1: 174,581,955 T585A unknown Het
Gm7135 T C 1: 97,469,895 noncoding transcript Het
Gm8104 G T 14: 43,101,634 D94Y probably damaging Het
Hjurp G C 1: 88,277,215 probably benign Het
Ino80b G C 6: 83,122,333 P178R probably damaging Het
Kbtbd4 T C 2: 90,909,755 F495L probably damaging Het
Lingo2 T C 4: 35,709,810 I57V probably benign Het
Me2 T C 18: 73,791,085 K352R probably benign Het
Mthfsd A G 8: 121,105,626 V133A probably damaging Het
Nav2 T A 7: 49,572,298 probably null Het
Nav2 T A 7: 49,597,231 I2168N probably damaging Het
Nlrp10 T A 7: 108,924,341 D644V possibly damaging Het
Olfr1472 T C 19: 13,454,471 I15M probably benign Het
Olfr148 A G 9: 39,613,957 Y130C possibly damaging Het
Olfr15 T C 16: 3,839,570 L199P probably damaging Het
Oplah C T 15: 76,302,710 R635H probably damaging Het
Peli1 A G 11: 21,147,115 probably null Het
Pfkfb1 A T X: 150,622,188 D208V possibly damaging Het
Pld5 T G 1: 175,993,875 T242P probably damaging Het
Rbm5 A G 9: 107,750,483 S420P probably benign Het
Rhag A T 17: 40,831,653 I250F probably damaging Het
Rnase4 A G 14: 51,105,005 K62R probably benign Het
Scaf4 C T 16: 90,260,215 V83I unknown Het
Slc24a2 A G 4: 87,227,205 V204A probably damaging Het
Slc5a8 G T 10: 88,911,413 L409F probably damaging Het
Spns3 A T 11: 72,538,361 V199E probably damaging Het
Sspo A G 6: 48,478,293 T3030A probably benign Het
Sstr2 A C 11: 113,624,656 T134P probably damaging Het
Stk39 G T 2: 68,220,920 T527K probably benign Het
Sult2a1 T A 7: 13,801,547 T194S probably benign Het
Tamm41 AGGG AGG 6: 115,012,359 probably benign Het
Trav7-3 A G 14: 53,443,746 T82A probably benign Het
Vmn2r85 A C 10: 130,418,705 C703W probably damaging Het
Vmn2r92 G A 17: 18,184,261 V556M possibly damaging Het
Zfp292 T C 4: 34,806,079 I2322V probably benign Het
Zfp644 T C 5: 106,618,276 E93G probably damaging Het
Zfp81 C T 17: 33,334,916 C308Y probably damaging Het
Other mutations in Umodl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Umodl1 APN 17 31008750 utr 3 prime probably benign
IGL01344:Umodl1 APN 17 30996264 missense probably damaging 0.99
IGL01529:Umodl1 APN 17 30996259 missense possibly damaging 0.94
IGL01609:Umodl1 APN 17 30998826 missense possibly damaging 0.90
IGL01625:Umodl1 APN 17 30996255 missense probably benign 0.00
IGL01877:Umodl1 APN 17 30982320 missense probably benign 0.00
IGL01977:Umodl1 APN 17 30973768 missense probably damaging 0.99
IGL02063:Umodl1 APN 17 30987914 missense probably benign 0.07
IGL02160:Umodl1 APN 17 30986117 missense probably damaging 0.97
IGL02252:Umodl1 APN 17 30994815 critical splice donor site probably null
IGL02427:Umodl1 APN 17 30968441 splice site probably benign
IGL02496:Umodl1 APN 17 30998654 missense probably damaging 0.99
IGL02633:Umodl1 APN 17 30989488 missense probably damaging 1.00
IGL03271:Umodl1 APN 17 30986499 nonsense probably null
IGL03392:Umodl1 APN 17 30996355 missense probably damaging 0.98
floored UTSW 17 30988057 nonsense probably null
surprising UTSW 17 30986465 missense possibly damaging 0.77
unsettling UTSW 17 30986554 nonsense probably null
PIT4468001:Umodl1 UTSW 17 30959278 missense probably damaging 1.00
R0048:Umodl1 UTSW 17 30968477 missense probably damaging 1.00
R0048:Umodl1 UTSW 17 30968477 missense probably damaging 1.00
R0653:Umodl1 UTSW 17 30984028 missense probably benign 0.00
R0831:Umodl1 UTSW 17 30996351 missense probably damaging 1.00
R1078:Umodl1 UTSW 17 30959373 missense probably benign 0.00
R1166:Umodl1 UTSW 17 31002798 splice site probably benign
R1231:Umodl1 UTSW 17 30959278 missense probably damaging 1.00
R1459:Umodl1 UTSW 17 30982258 splice site probably benign
R1459:Umodl1 UTSW 17 30986504 missense probably benign 0.05
R1510:Umodl1 UTSW 17 30959229 missense probably damaging 1.00
R1654:Umodl1 UTSW 17 30987968 missense probably benign
R1757:Umodl1 UTSW 17 31008700 missense probably damaging 0.99
R1781:Umodl1 UTSW 17 30968550 missense probably damaging 1.00
R1873:Umodl1 UTSW 17 30982264 missense probably damaging 0.99
R1911:Umodl1 UTSW 17 30992154 missense possibly damaging 0.74
R1917:Umodl1 UTSW 17 30984043 missense probably damaging 1.00
R1918:Umodl1 UTSW 17 30984043 missense probably damaging 1.00
R2057:Umodl1 UTSW 17 31008766 critical splice donor site probably null
R2058:Umodl1 UTSW 17 31008766 critical splice donor site probably null
R2089:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2091:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2091:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2431:Umodl1 UTSW 17 30992088 missense possibly damaging 0.79
R2903:Umodl1 UTSW 17 30992173 missense probably damaging 1.00
R3032:Umodl1 UTSW 17 30989528 missense probably benign 0.01
R3956:Umodl1 UTSW 17 31002863 missense probably benign 0.10
R3975:Umodl1 UTSW 17 30984789 nonsense probably null
R4287:Umodl1 UTSW 17 30988065 missense probably benign 0.11
R4452:Umodl1 UTSW 17 30994815 critical splice donor site probably null
R4684:Umodl1 UTSW 17 30998114 missense probably benign 0.00
R4769:Umodl1 UTSW 17 30984002 missense possibly damaging 0.92
R4887:Umodl1 UTSW 17 31008665 missense probably benign 0.06
R4888:Umodl1 UTSW 17 30999201 missense probably damaging 1.00
R4978:Umodl1 UTSW 17 30986081 missense probably benign
R4993:Umodl1 UTSW 17 30986485 missense probably benign 0.00
R5241:Umodl1 UTSW 17 30984092 missense probably benign 0.18
R5254:Umodl1 UTSW 17 30980359 missense possibly damaging 0.86
R5454:Umodl1 UTSW 17 30986465 missense possibly damaging 0.77
R5456:Umodl1 UTSW 17 30982289 missense probably benign 0.04
R5754:Umodl1 UTSW 17 30994787 missense probably damaging 0.96
R6189:Umodl1 UTSW 17 30996282 missense possibly damaging 0.75
R6222:Umodl1 UTSW 17 31002892 critical splice donor site probably null
R6289:Umodl1 UTSW 17 30982351 missense probably benign 0.16
R6432:Umodl1 UTSW 17 30986147 missense probably benign 0.38
R6478:Umodl1 UTSW 17 30959155 missense probably damaging 1.00
R6702:Umodl1 UTSW 17 30986299 splice site probably null
R6822:Umodl1 UTSW 17 30986554 nonsense probably null
R6999:Umodl1 UTSW 17 30999123 missense probably damaging 1.00
R7067:Umodl1 UTSW 17 30982272 missense probably damaging 1.00
R7123:Umodl1 UTSW 17 30982344 missense possibly damaging 0.90
R7219:Umodl1 UTSW 17 30982262 critical splice acceptor site probably null
R7231:Umodl1 UTSW 17 30986116 missense probably damaging 1.00
R7234:Umodl1 UTSW 17 30986621 missense possibly damaging 0.87
R7297:Umodl1 UTSW 17 31008665 missense probably benign 0.06
R7392:Umodl1 UTSW 17 30982332 missense probably damaging 0.99
R7401:Umodl1 UTSW 17 30998148 missense probably damaging 1.00
R7461:Umodl1 UTSW 17 30988057 nonsense probably null
R7594:Umodl1 UTSW 17 30954805 missense probably benign 0.02
R7613:Umodl1 UTSW 17 30988057 nonsense probably null
R7763:Umodl1 UTSW 17 30986456 missense probably benign 0.24
R7797:Umodl1 UTSW 17 30959151 missense probably benign 0.02
R7832:Umodl1 UTSW 17 30973692 critical splice acceptor site probably null
R8088:Umodl1 UTSW 17 30973796 missense probably benign 0.29
R8111:Umodl1 UTSW 17 30971818 missense probably damaging 0.99
R8314:Umodl1 UTSW 17 30984832 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAAGTGTCCAGAAGCTGCAG -3'
(R):5'- TCAGAAATCTGGGGATGGGTTC -3'

Sequencing Primer
(F):5'- AGGCTGTGCAGACCTCTCAC -3'
(R):5'- GTTCATGAGAAGCACCCCAG -3'
Posted On2015-06-10