Incidental Mutation 'R4207:Umodl1'
ID 318998
Institutional Source Beutler Lab
Gene Symbol Umodl1
Ensembl Gene ENSMUSG00000054134
Gene Name uromodulin-like 1
Synonyms D17Ertd488e
MMRRC Submission 041036-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4207 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 30954679-31010708 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 30959367 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 106 (V106I)
Ref Sequence ENSEMBL: ENSMUSP00000110202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066554] [ENSMUST00000066981] [ENSMUST00000114555]
AlphaFold Q5DID3
Predicted Effect probably damaging
Transcript: ENSMUST00000066554
AA Change: V106I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000067443
Gene: ENSMUSG00000054134
AA Change: V106I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000066981
AA Change: V106I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065470
Gene: ENSMUSG00000054134
AA Change: V106I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 8.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 8.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 619 632 N/A INTRINSIC
SEA 706 821 8.88e-2 SMART
EGF 818 859 4.26e0 SMART
ZP 909 1152 5.44e-25 SMART
transmembrane domain 1186 1208 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114555
AA Change: V106I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110202
Gene: ENSMUSG00000054134
AA Change: V106I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 9.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 9.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Meta Mutation Damage Score 0.0836 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b G A 11: 109,981,725 Q17* probably null Het
Acap2 T A 16: 31,119,427 N293I probably damaging Het
Adgrg4 G A X: 56,918,749 V1893I possibly damaging Het
Aff1 T C 5: 103,818,988 probably null Het
Ap1b1 A G 11: 5,031,637 D515G probably damaging Het
Brk1 T C 6: 113,615,844 Y63H possibly damaging Het
Cand1 T C 10: 119,211,845 D580G probably damaging Het
Casp4 A G 9: 5,328,451 D311G probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Ctnnd2 G T 15: 30,972,827 V1033F probably damaging Het
Dhx29 G T 13: 112,927,949 A53S probably benign Het
Dis3 T G 14: 99,095,316 I227L probably benign Het
Efhc2 T C X: 17,230,550 N186S possibly damaging Het
Efl1 T C 7: 82,750,816 V592A probably damaging Het
Elovl7 A T 13: 108,282,506 Q224L possibly damaging Het
Fcgr3 T A 1: 171,054,075 K160N probably benign Het
Flg A G 3: 93,279,862 Y207C probably benign Het
Fmn2 A G 1: 174,581,955 T585A unknown Het
Gm7135 T C 1: 97,469,895 noncoding transcript Het
Gm8104 G T 14: 43,101,634 D94Y probably damaging Het
Hjurp G C 1: 88,277,215 probably benign Het
Ino80b G C 6: 83,122,333 P178R probably damaging Het
Kbtbd4 T C 2: 90,909,755 F495L probably damaging Het
Lingo2 T C 4: 35,709,810 I57V probably benign Het
Me2 T C 18: 73,791,085 K352R probably benign Het
Mthfsd A G 8: 121,105,626 V133A probably damaging Het
Nav2 T A 7: 49,572,298 probably null Het
Nav2 T A 7: 49,597,231 I2168N probably damaging Het
Nlrp10 T A 7: 108,924,341 D644V possibly damaging Het
Olfr1472 T C 19: 13,454,471 I15M probably benign Het
Olfr148 A G 9: 39,613,957 Y130C possibly damaging Het
Olfr15 T C 16: 3,839,570 L199P probably damaging Het
Oplah C T 15: 76,302,710 R635H probably damaging Het
Peli1 A G 11: 21,147,115 probably null Het
Pfkfb1 A T X: 150,622,188 D208V possibly damaging Het
Pld5 T G 1: 175,993,875 T242P probably damaging Het
Rbm5 A G 9: 107,750,483 S420P probably benign Het
Rhag A T 17: 40,831,653 I250F probably damaging Het
Rnase4 A G 14: 51,105,005 K62R probably benign Het
Scaf4 C T 16: 90,260,215 V83I unknown Het
Slc24a2 A G 4: 87,227,205 V204A probably damaging Het
Slc5a8 G T 10: 88,911,413 L409F probably damaging Het
Spns3 A T 11: 72,538,361 V199E probably damaging Het
Sspo A G 6: 48,478,293 T3030A probably benign Het
Sstr2 A C 11: 113,624,656 T134P probably damaging Het
Stk39 G T 2: 68,220,920 T527K probably benign Het
Sult2a1 T A 7: 13,801,547 T194S probably benign Het
Tamm41 AGGG AGG 6: 115,012,359 probably benign Het
Trav7-3 A G 14: 53,443,746 T82A probably benign Het
Vmn2r85 A C 10: 130,418,705 C703W probably damaging Het
Vmn2r92 G A 17: 18,184,261 V556M possibly damaging Het
Zfp292 T C 4: 34,806,079 I2322V probably benign Het
Zfp644 T C 5: 106,618,276 E93G probably damaging Het
Zfp81 C T 17: 33,334,916 C308Y probably damaging Het
Other mutations in Umodl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Umodl1 APN 17 31008750 utr 3 prime probably benign
IGL01344:Umodl1 APN 17 30996264 missense probably damaging 0.99
IGL01529:Umodl1 APN 17 30996259 missense possibly damaging 0.94
IGL01609:Umodl1 APN 17 30998826 missense possibly damaging 0.90
IGL01625:Umodl1 APN 17 30996255 missense probably benign 0.00
IGL01877:Umodl1 APN 17 30982320 missense probably benign 0.00
IGL01977:Umodl1 APN 17 30973768 missense probably damaging 0.99
IGL02063:Umodl1 APN 17 30987914 missense probably benign 0.07
IGL02160:Umodl1 APN 17 30986117 missense probably damaging 0.97
IGL02252:Umodl1 APN 17 30994815 critical splice donor site probably null
IGL02427:Umodl1 APN 17 30968441 splice site probably benign
IGL02496:Umodl1 APN 17 30998654 missense probably damaging 0.99
IGL02633:Umodl1 APN 17 30989488 missense probably damaging 1.00
IGL03271:Umodl1 APN 17 30986499 nonsense probably null
IGL03392:Umodl1 APN 17 30996355 missense probably damaging 0.98
Disquieting UTSW 17 30959155 missense probably damaging 1.00
floored UTSW 17 30988057 nonsense probably null
R7231_umodl1_507 UTSW 17 30986116 missense probably damaging 1.00
surprising UTSW 17 30986465 missense possibly damaging 0.77
unsettling UTSW 17 30986554 nonsense probably null
G1citation:Umodl1 UTSW 17 30986554 nonsense probably null
PIT4468001:Umodl1 UTSW 17 30959278 missense probably damaging 1.00
R0048:Umodl1 UTSW 17 30968477 missense probably damaging 1.00
R0048:Umodl1 UTSW 17 30968477 missense probably damaging 1.00
R0653:Umodl1 UTSW 17 30984028 missense probably benign 0.00
R0831:Umodl1 UTSW 17 30996351 missense probably damaging 1.00
R1078:Umodl1 UTSW 17 30959373 missense probably benign 0.00
R1166:Umodl1 UTSW 17 31002798 splice site probably benign
R1231:Umodl1 UTSW 17 30959278 missense probably damaging 1.00
R1459:Umodl1 UTSW 17 30982258 splice site probably benign
R1459:Umodl1 UTSW 17 30986504 missense probably benign 0.05
R1510:Umodl1 UTSW 17 30959229 missense probably damaging 1.00
R1654:Umodl1 UTSW 17 30987968 missense probably benign
R1757:Umodl1 UTSW 17 31008700 missense probably damaging 0.99
R1781:Umodl1 UTSW 17 30968550 missense probably damaging 1.00
R1873:Umodl1 UTSW 17 30982264 missense probably damaging 0.99
R1911:Umodl1 UTSW 17 30992154 missense possibly damaging 0.74
R1917:Umodl1 UTSW 17 30984043 missense probably damaging 1.00
R1918:Umodl1 UTSW 17 30984043 missense probably damaging 1.00
R2057:Umodl1 UTSW 17 31008766 critical splice donor site probably null
R2058:Umodl1 UTSW 17 31008766 critical splice donor site probably null
R2089:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2091:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2091:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2431:Umodl1 UTSW 17 30992088 missense possibly damaging 0.79
R2903:Umodl1 UTSW 17 30992173 missense probably damaging 1.00
R3032:Umodl1 UTSW 17 30989528 missense probably benign 0.01
R3956:Umodl1 UTSW 17 31002863 missense probably benign 0.10
R3975:Umodl1 UTSW 17 30984789 nonsense probably null
R4287:Umodl1 UTSW 17 30988065 missense probably benign 0.11
R4452:Umodl1 UTSW 17 30994815 critical splice donor site probably null
R4684:Umodl1 UTSW 17 30998114 missense probably benign 0.00
R4769:Umodl1 UTSW 17 30984002 missense possibly damaging 0.92
R4887:Umodl1 UTSW 17 31008665 missense probably benign 0.06
R4888:Umodl1 UTSW 17 30999201 missense probably damaging 1.00
R4978:Umodl1 UTSW 17 30986081 missense probably benign
R4993:Umodl1 UTSW 17 30986485 missense probably benign 0.00
R5241:Umodl1 UTSW 17 30984092 missense probably benign 0.18
R5254:Umodl1 UTSW 17 30980359 missense possibly damaging 0.86
R5454:Umodl1 UTSW 17 30986465 missense possibly damaging 0.77
R5456:Umodl1 UTSW 17 30982289 missense probably benign 0.04
R5754:Umodl1 UTSW 17 30994787 missense probably damaging 0.96
R6189:Umodl1 UTSW 17 30996282 missense possibly damaging 0.75
R6222:Umodl1 UTSW 17 31002892 critical splice donor site probably null
R6289:Umodl1 UTSW 17 30982351 missense probably benign 0.16
R6432:Umodl1 UTSW 17 30986147 missense probably benign 0.38
R6478:Umodl1 UTSW 17 30959155 missense probably damaging 1.00
R6702:Umodl1 UTSW 17 30986299 splice site probably null
R6822:Umodl1 UTSW 17 30986554 nonsense probably null
R6999:Umodl1 UTSW 17 30999123 missense probably damaging 1.00
R7067:Umodl1 UTSW 17 30982272 missense probably damaging 1.00
R7123:Umodl1 UTSW 17 30982344 missense possibly damaging 0.90
R7219:Umodl1 UTSW 17 30982262 critical splice acceptor site probably null
R7231:Umodl1 UTSW 17 30986116 missense probably damaging 1.00
R7234:Umodl1 UTSW 17 30986621 missense possibly damaging 0.87
R7297:Umodl1 UTSW 17 31008665 missense probably benign 0.06
R7392:Umodl1 UTSW 17 30982332 missense probably damaging 0.99
R7401:Umodl1 UTSW 17 30998148 missense probably damaging 1.00
R7461:Umodl1 UTSW 17 30988057 nonsense probably null
R7594:Umodl1 UTSW 17 30954805 missense probably benign 0.02
R7613:Umodl1 UTSW 17 30988057 nonsense probably null
R7763:Umodl1 UTSW 17 30986456 missense probably benign 0.24
R7797:Umodl1 UTSW 17 30959151 missense probably benign 0.02
R7832:Umodl1 UTSW 17 30973692 critical splice acceptor site probably null
R7954:Umodl1 UTSW 17 30986387 missense probably benign 0.00
R8088:Umodl1 UTSW 17 30973796 missense probably benign 0.29
R8111:Umodl1 UTSW 17 30971818 missense probably damaging 0.99
R8314:Umodl1 UTSW 17 30984832 missense probably damaging 0.99
R8826:Umodl1 UTSW 17 30983984 missense possibly damaging 0.65
R9067:Umodl1 UTSW 17 30973703 missense probably damaging 1.00
R9091:Umodl1 UTSW 17 30966704 missense probably damaging 1.00
R9099:Umodl1 UTSW 17 30959173 missense probably benign 0.01
R9270:Umodl1 UTSW 17 30966704 missense probably damaging 1.00
R9341:Umodl1 UTSW 17 30998727 missense possibly damaging 0.95
R9343:Umodl1 UTSW 17 30998727 missense possibly damaging 0.95
R9400:Umodl1 UTSW 17 30996393 missense probably damaging 0.99
R9569:Umodl1 UTSW 17 30998169 missense probably damaging 1.00
R9615:Umodl1 UTSW 17 30998178 missense possibly damaging 0.94
R9787:Umodl1 UTSW 17 30959350 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGTGTCCAGAAGCTGCAG -3'
(R):5'- TCAGAAATCTGGGGATGGGTTC -3'

Sequencing Primer
(F):5'- AGGCTGTGCAGACCTCTCAC -3'
(R):5'- GTTCATGAGAAGCACCCCAG -3'
Posted On 2015-06-10