Incidental Mutation 'R4207:Zfp81'
ID 318999
Institutional Source Beutler Lab
Gene Symbol Zfp81
Ensembl Gene ENSMUSG00000003929
Gene Name zinc finger protein 81
Synonyms Hszfp36, D330034E10Rik, KRAB13, C330034P10Rik, Zfp78
MMRRC Submission 041036-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.303) question?
Stock # R4207 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 33548316-33577852 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 33553890 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 308 (C308Y)
Ref Sequence ENSEMBL: ENSMUSP00000050728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054072]
AlphaFold B8JJZ7
Predicted Effect probably damaging
Transcript: ENSMUST00000054072
AA Change: C308Y

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000050728
Gene: ENSMUSG00000003929
AA Change: C308Y

DomainStartEndE-ValueType
KRAB 4 55 1.15e-14 SMART
ZnF_C2H2 222 244 1.04e-3 SMART
ZnF_C2H2 250 272 1.53e-1 SMART
ZnF_C2H2 278 300 1.33e-1 SMART
ZnF_C2H2 306 328 5.21e-4 SMART
ZnF_C2H2 334 356 2.2e-2 SMART
ZnF_C2H2 362 384 1.58e-3 SMART
ZnF_C2H2 390 412 1.64e-1 SMART
ZnF_C2H2 418 440 7.67e-2 SMART
ZnF_C2H2 446 468 1.89e-1 SMART
ZnF_C2H2 474 496 2.86e-1 SMART
ZnF_C2H2 502 524 1.08e-1 SMART
Meta Mutation Damage Score 0.4244 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b G A 11: 109,872,551 (GRCm39) Q17* probably null Het
Acap2 T A 16: 30,938,245 (GRCm39) N293I probably damaging Het
Adgrg4 G A X: 55,964,109 (GRCm39) V1893I possibly damaging Het
Aff1 T C 5: 103,966,854 (GRCm39) probably null Het
Ap1b1 A G 11: 4,981,637 (GRCm39) D515G probably damaging Het
Brk1 T C 6: 113,592,805 (GRCm39) Y63H possibly damaging Het
Cand1 T C 10: 119,047,750 (GRCm39) D580G probably damaging Het
Casp4 A G 9: 5,328,451 (GRCm39) D311G probably benign Het
Crygs C T 16: 22,624,301 (GRCm39) G102D possibly damaging Het
Ctnnd2 G T 15: 30,972,973 (GRCm39) V1033F probably damaging Het
Dhx29 G T 13: 113,064,483 (GRCm39) A53S probably benign Het
Dis3 T G 14: 99,332,752 (GRCm39) I227L probably benign Het
Efhc2 T C X: 17,096,789 (GRCm39) N186S possibly damaging Het
Efl1 T C 7: 82,400,024 (GRCm39) V592A probably damaging Het
Elovl7 A T 13: 108,419,040 (GRCm39) Q224L possibly damaging Het
Fcgr3 T A 1: 170,881,644 (GRCm39) K160N probably benign Het
Flg A G 3: 93,187,169 (GRCm39) Y207C probably benign Het
Fmn2 A G 1: 174,409,521 (GRCm39) T585A unknown Het
Gm7135 T C 1: 97,397,620 (GRCm39) noncoding transcript Het
Gm8104 G T 14: 42,959,091 (GRCm39) D94Y probably damaging Het
Hjurp G C 1: 88,204,937 (GRCm39) probably benign Het
Ino80b G C 6: 83,099,314 (GRCm39) P178R probably damaging Het
Kbtbd4 T C 2: 90,740,099 (GRCm39) F495L probably damaging Het
Lingo2 T C 4: 35,709,810 (GRCm39) I57V probably benign Het
Me2 T C 18: 73,924,156 (GRCm39) K352R probably benign Het
Mthfsd A G 8: 121,832,365 (GRCm39) V133A probably damaging Het
Nav2 T A 7: 49,246,979 (GRCm39) I2168N probably damaging Het
Nav2 T A 7: 49,222,046 (GRCm39) probably null Het
Nlrp10 T A 7: 108,523,548 (GRCm39) D644V possibly damaging Het
Oplah C T 15: 76,186,910 (GRCm39) R635H probably damaging Het
Or10n1 A G 9: 39,525,253 (GRCm39) Y130C possibly damaging Het
Or2c1 T C 16: 3,657,434 (GRCm39) L199P probably damaging Het
Or5b117 T C 19: 13,431,835 (GRCm39) I15M probably benign Het
Peli1 A G 11: 21,097,115 (GRCm39) probably null Het
Pfkfb1 A T X: 149,405,184 (GRCm39) D208V possibly damaging Het
Pld5 T G 1: 175,821,441 (GRCm39) T242P probably damaging Het
Rbm5 A G 9: 107,627,682 (GRCm39) S420P probably benign Het
Rhag A T 17: 41,142,544 (GRCm39) I250F probably damaging Het
Rnase4 A G 14: 51,342,462 (GRCm39) K62R probably benign Het
Scaf4 C T 16: 90,057,103 (GRCm39) V83I unknown Het
Slc24a2 A G 4: 87,145,442 (GRCm39) V204A probably damaging Het
Slc5a8 G T 10: 88,747,275 (GRCm39) L409F probably damaging Het
Spns3 A T 11: 72,429,187 (GRCm39) V199E probably damaging Het
Sspo A G 6: 48,455,227 (GRCm39) T3030A probably benign Het
Sstr2 A C 11: 113,515,482 (GRCm39) T134P probably damaging Het
Stk39 G T 2: 68,051,264 (GRCm39) T527K probably benign Het
Sult2a1 T A 7: 13,535,472 (GRCm39) T194S probably benign Het
Tamm41 AGGG AGG 6: 114,989,320 (GRCm39) probably benign Het
Trav7-3 A G 14: 53,681,203 (GRCm39) T82A probably benign Het
Umodl1 G A 17: 31,178,341 (GRCm39) V106I probably damaging Het
Vmn2r85 A C 10: 130,254,574 (GRCm39) C703W probably damaging Het
Vmn2r92 G A 17: 18,404,523 (GRCm39) V556M possibly damaging Het
Zfp292 T C 4: 34,806,079 (GRCm39) I2322V probably benign Het
Zfp644 T C 5: 106,766,142 (GRCm39) E93G probably damaging Het
Other mutations in Zfp81
AlleleSourceChrCoordTypePredicted EffectPPH Score
feuer UTSW 17 33,553,307 (GRCm39) nonsense probably null
R0143:Zfp81 UTSW 17 33,554,095 (GRCm39) missense possibly damaging 0.85
R0220:Zfp81 UTSW 17 33,555,698 (GRCm39) missense possibly damaging 0.93
R0520:Zfp81 UTSW 17 33,553,351 (GRCm39) missense probably damaging 0.97
R0611:Zfp81 UTSW 17 33,553,593 (GRCm39) missense probably benign 0.02
R1171:Zfp81 UTSW 17 33,554,254 (GRCm39) missense probably benign
R1613:Zfp81 UTSW 17 33,553,757 (GRCm39) missense probably damaging 0.98
R1779:Zfp81 UTSW 17 33,554,080 (GRCm39) missense probably benign 0.06
R1970:Zfp81 UTSW 17 33,554,475 (GRCm39) missense probably benign
R2063:Zfp81 UTSW 17 33,554,278 (GRCm39) missense probably benign 0.03
R2314:Zfp81 UTSW 17 33,553,597 (GRCm39) missense probably damaging 0.99
R2898:Zfp81 UTSW 17 33,553,274 (GRCm39) nonsense probably null
R3115:Zfp81 UTSW 17 33,553,537 (GRCm39) missense possibly damaging 0.80
R4497:Zfp81 UTSW 17 33,553,677 (GRCm39) missense possibly damaging 0.47
R4498:Zfp81 UTSW 17 33,553,677 (GRCm39) missense possibly damaging 0.47
R5756:Zfp81 UTSW 17 33,553,307 (GRCm39) nonsense probably null
R5964:Zfp81 UTSW 17 33,555,819 (GRCm39) missense probably damaging 0.99
R6671:Zfp81 UTSW 17 33,554,413 (GRCm39) missense probably benign 0.17
R7728:Zfp81 UTSW 17 33,555,791 (GRCm39) missense possibly damaging 0.95
R9047:Zfp81 UTSW 17 33,553,387 (GRCm39) missense probably damaging 1.00
R9561:Zfp81 UTSW 17 33,553,774 (GRCm39) missense probably benign 0.15
R9800:Zfp81 UTSW 17 33,554,411 (GRCm39) nonsense probably null
Z1176:Zfp81 UTSW 17 33,553,803 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TACATTGGTATAAGTTCTACCCACTAG -3'
(R):5'- ATGTAGTTATGGTCAGTCATATGAAAG -3'

Sequencing Primer
(F):5'- ATAGGTGAAGGCTTTCCCAC -3'
(R):5'- GGAGAAGCCTTTGTTAATTCCAGTC -3'
Posted On 2015-06-10