Incidental Mutation 'R4207:Rhag'
ID319000
Institutional Source Beutler Lab
Gene Symbol Rhag
Ensembl Gene ENSMUSG00000023926
Gene NameRhesus blood group-associated A glycoprotein
SynonymsRh50, CD241, Rh50A
MMRRC Submission 041036-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R4207 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location40811126-40840754 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 40831653 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 250 (I250F)
Ref Sequence ENSEMBL: ENSMUSP00000024721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024721]
Predicted Effect probably damaging
Transcript: ENSMUST00000024721
AA Change: I250F

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000024721
Gene: ENSMUSG00000023926
AA Change: I250F

DomainStartEndE-ValueType
Pfam:Ammonium_transp 43 412 1.5e-83 PFAM
Meta Mutation Damage Score 0.5899 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is erythrocyte-specific and is thought to be part of a membrane channel that transports ammonium and carbon dioxide across the blood cell membrane. The encoded protein appears to interact with Rh blood group antigens and Rh30 polypeptides. Defects in this gene are a cause of regulator type Rh-null hemolytic anemia (RHN), or Rh-deficiency syndrome.[provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased ammonium and methylammonium transport in red cell ghosts, reduced basal adhesion of red blood cells to endothelial cells, a slight increase in iron levels, and decreased transferrin levels in males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b G A 11: 109,981,725 Q17* probably null Het
Acap2 T A 16: 31,119,427 N293I probably damaging Het
Adgrg4 G A X: 56,918,749 V1893I possibly damaging Het
Aff1 T C 5: 103,818,988 probably null Het
Ap1b1 A G 11: 5,031,637 D515G probably damaging Het
Brk1 T C 6: 113,615,844 Y63H possibly damaging Het
Cand1 T C 10: 119,211,845 D580G probably damaging Het
Casp4 A G 9: 5,328,451 D311G probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Ctnnd2 G T 15: 30,972,827 V1033F probably damaging Het
Dhx29 G T 13: 112,927,949 A53S probably benign Het
Dis3 T G 14: 99,095,316 I227L probably benign Het
Efhc2 T C X: 17,230,550 N186S possibly damaging Het
Efl1 T C 7: 82,750,816 V592A probably damaging Het
Elovl7 A T 13: 108,282,506 Q224L possibly damaging Het
Fcgr3 T A 1: 171,054,075 K160N probably benign Het
Flg A G 3: 93,279,862 Y207C probably benign Het
Fmn2 A G 1: 174,581,955 T585A unknown Het
Gm7135 T C 1: 97,469,895 noncoding transcript Het
Gm8104 G T 14: 43,101,634 D94Y probably damaging Het
Hjurp G C 1: 88,277,215 probably benign Het
Ino80b G C 6: 83,122,333 P178R probably damaging Het
Kbtbd4 T C 2: 90,909,755 F495L probably damaging Het
Lingo2 T C 4: 35,709,810 I57V probably benign Het
Me2 T C 18: 73,791,085 K352R probably benign Het
Mthfsd A G 8: 121,105,626 V133A probably damaging Het
Nav2 T A 7: 49,572,298 probably null Het
Nav2 T A 7: 49,597,231 I2168N probably damaging Het
Nlrp10 T A 7: 108,924,341 D644V possibly damaging Het
Olfr1472 T C 19: 13,454,471 I15M probably benign Het
Olfr148 A G 9: 39,613,957 Y130C possibly damaging Het
Olfr15 T C 16: 3,839,570 L199P probably damaging Het
Oplah C T 15: 76,302,710 R635H probably damaging Het
Peli1 A G 11: 21,147,115 probably null Het
Pfkfb1 A T X: 150,622,188 D208V possibly damaging Het
Pld5 T G 1: 175,993,875 T242P probably damaging Het
Rbm5 A G 9: 107,750,483 S420P probably benign Het
Rnase4 A G 14: 51,105,005 K62R probably benign Het
Scaf4 C T 16: 90,260,215 V83I unknown Het
Slc24a2 A G 4: 87,227,205 V204A probably damaging Het
Slc5a8 G T 10: 88,911,413 L409F probably damaging Het
Spns3 A T 11: 72,538,361 V199E probably damaging Het
Sspo A G 6: 48,478,293 T3030A probably benign Het
Sstr2 A C 11: 113,624,656 T134P probably damaging Het
Stk39 G T 2: 68,220,920 T527K probably benign Het
Sult2a1 T A 7: 13,801,547 T194S probably benign Het
Tamm41 AGGG AGG 6: 115,012,359 probably benign Het
Trav7-3 A G 14: 53,443,746 T82A probably benign Het
Umodl1 G A 17: 30,959,367 V106I probably damaging Het
Vmn2r85 A C 10: 130,418,705 C703W probably damaging Het
Vmn2r92 G A 17: 18,184,261 V556M possibly damaging Het
Zfp292 T C 4: 34,806,079 I2322V probably benign Het
Zfp644 T C 5: 106,618,276 E93G probably damaging Het
Zfp81 C T 17: 33,334,916 C308Y probably damaging Het
Other mutations in Rhag
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Rhag APN 17 40811287 missense possibly damaging 0.73
IGL01463:Rhag APN 17 40828755 missense probably damaging 1.00
IGL01954:Rhag APN 17 40828450 missense possibly damaging 0.88
IGL03000:Rhag APN 17 40828522 missense probably benign 0.00
R0385:Rhag UTSW 17 40834727 missense probably damaging 0.97
R0570:Rhag UTSW 17 40828913 splice site probably benign
R0811:Rhag UTSW 17 40831578 missense possibly damaging 0.74
R0812:Rhag UTSW 17 40831578 missense possibly damaging 0.74
R1655:Rhag UTSW 17 40831596 missense probably damaging 0.98
R2376:Rhag UTSW 17 40811363 critical splice donor site probably null
R2698:Rhag UTSW 17 40836476 missense probably damaging 0.99
R4695:Rhag UTSW 17 40836467 missense probably damaging 0.99
R4705:Rhag UTSW 17 40836438 missense probably benign 0.35
R4729:Rhag UTSW 17 40828401 missense probably damaging 1.00
R4790:Rhag UTSW 17 40831290 missense probably benign 0.23
R4895:Rhag UTSW 17 40811351 missense probably benign
R5224:Rhag UTSW 17 40828504 missense probably damaging 0.98
R5685:Rhag UTSW 17 40831331 missense possibly damaging 0.88
R7403:Rhag UTSW 17 40834658 missense probably damaging 1.00
R7407:Rhag UTSW 17 40831334 missense possibly damaging 0.56
R7553:Rhag UTSW 17 40828395 missense probably damaging 1.00
X0064:Rhag UTSW 17 40833505 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TATGGTGGGTCAGTAGTCCC -3'
(R):5'- TTCTGTCTGATTTTAACTGACCAGC -3'

Sequencing Primer
(F):5'- TGCCTCACTTTTTGATGATCAAG -3'
(R):5'- GACCAGCATAAATTACAAAACTGTG -3'
Posted On2015-06-10