Incidental Mutation 'R4207:Rhag'
ID 319000
Institutional Source Beutler Lab
Gene Symbol Rhag
Ensembl Gene ENSMUSG00000023926
Gene Name Rhesus blood group-associated A glycoprotein
Synonyms Rh50, CD241, Rh50A
MMRRC Submission 041036-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.108) question?
Stock # R4207 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 41122017-41151645 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 41142544 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 250 (I250F)
Ref Sequence ENSEMBL: ENSMUSP00000024721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024721]
AlphaFold Q9QUT0
Predicted Effect probably damaging
Transcript: ENSMUST00000024721
AA Change: I250F

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000024721
Gene: ENSMUSG00000023926
AA Change: I250F

DomainStartEndE-ValueType
Pfam:Ammonium_transp 43 412 1.5e-83 PFAM
Meta Mutation Damage Score 0.5899 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is erythrocyte-specific and is thought to be part of a membrane channel that transports ammonium and carbon dioxide across the blood cell membrane. The encoded protein appears to interact with Rh blood group antigens and Rh30 polypeptides. Defects in this gene are a cause of regulator type Rh-null hemolytic anemia (RHN), or Rh-deficiency syndrome.[provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased ammonium and methylammonium transport in red cell ghosts, reduced basal adhesion of red blood cells to endothelial cells, a slight increase in iron levels, and decreased transferrin levels in males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b G A 11: 109,872,551 (GRCm39) Q17* probably null Het
Acap2 T A 16: 30,938,245 (GRCm39) N293I probably damaging Het
Adgrg4 G A X: 55,964,109 (GRCm39) V1893I possibly damaging Het
Aff1 T C 5: 103,966,854 (GRCm39) probably null Het
Ap1b1 A G 11: 4,981,637 (GRCm39) D515G probably damaging Het
Brk1 T C 6: 113,592,805 (GRCm39) Y63H possibly damaging Het
Cand1 T C 10: 119,047,750 (GRCm39) D580G probably damaging Het
Casp4 A G 9: 5,328,451 (GRCm39) D311G probably benign Het
Crygs C T 16: 22,624,301 (GRCm39) G102D possibly damaging Het
Ctnnd2 G T 15: 30,972,973 (GRCm39) V1033F probably damaging Het
Dhx29 G T 13: 113,064,483 (GRCm39) A53S probably benign Het
Dis3 T G 14: 99,332,752 (GRCm39) I227L probably benign Het
Efhc2 T C X: 17,096,789 (GRCm39) N186S possibly damaging Het
Efl1 T C 7: 82,400,024 (GRCm39) V592A probably damaging Het
Elovl7 A T 13: 108,419,040 (GRCm39) Q224L possibly damaging Het
Fcgr3 T A 1: 170,881,644 (GRCm39) K160N probably benign Het
Flg A G 3: 93,187,169 (GRCm39) Y207C probably benign Het
Fmn2 A G 1: 174,409,521 (GRCm39) T585A unknown Het
Gm7135 T C 1: 97,397,620 (GRCm39) noncoding transcript Het
Gm8104 G T 14: 42,959,091 (GRCm39) D94Y probably damaging Het
Hjurp G C 1: 88,204,937 (GRCm39) probably benign Het
Ino80b G C 6: 83,099,314 (GRCm39) P178R probably damaging Het
Kbtbd4 T C 2: 90,740,099 (GRCm39) F495L probably damaging Het
Lingo2 T C 4: 35,709,810 (GRCm39) I57V probably benign Het
Me2 T C 18: 73,924,156 (GRCm39) K352R probably benign Het
Mthfsd A G 8: 121,832,365 (GRCm39) V133A probably damaging Het
Nav2 T A 7: 49,246,979 (GRCm39) I2168N probably damaging Het
Nav2 T A 7: 49,222,046 (GRCm39) probably null Het
Nlrp10 T A 7: 108,523,548 (GRCm39) D644V possibly damaging Het
Oplah C T 15: 76,186,910 (GRCm39) R635H probably damaging Het
Or10n1 A G 9: 39,525,253 (GRCm39) Y130C possibly damaging Het
Or2c1 T C 16: 3,657,434 (GRCm39) L199P probably damaging Het
Or5b117 T C 19: 13,431,835 (GRCm39) I15M probably benign Het
Peli1 A G 11: 21,097,115 (GRCm39) probably null Het
Pfkfb1 A T X: 149,405,184 (GRCm39) D208V possibly damaging Het
Pld5 T G 1: 175,821,441 (GRCm39) T242P probably damaging Het
Rbm5 A G 9: 107,627,682 (GRCm39) S420P probably benign Het
Rnase4 A G 14: 51,342,462 (GRCm39) K62R probably benign Het
Scaf4 C T 16: 90,057,103 (GRCm39) V83I unknown Het
Slc24a2 A G 4: 87,145,442 (GRCm39) V204A probably damaging Het
Slc5a8 G T 10: 88,747,275 (GRCm39) L409F probably damaging Het
Spns3 A T 11: 72,429,187 (GRCm39) V199E probably damaging Het
Sspo A G 6: 48,455,227 (GRCm39) T3030A probably benign Het
Sstr2 A C 11: 113,515,482 (GRCm39) T134P probably damaging Het
Stk39 G T 2: 68,051,264 (GRCm39) T527K probably benign Het
Sult2a1 T A 7: 13,535,472 (GRCm39) T194S probably benign Het
Tamm41 AGGG AGG 6: 114,989,320 (GRCm39) probably benign Het
Trav7-3 A G 14: 53,681,203 (GRCm39) T82A probably benign Het
Umodl1 G A 17: 31,178,341 (GRCm39) V106I probably damaging Het
Vmn2r85 A C 10: 130,254,574 (GRCm39) C703W probably damaging Het
Vmn2r92 G A 17: 18,404,523 (GRCm39) V556M possibly damaging Het
Zfp292 T C 4: 34,806,079 (GRCm39) I2322V probably benign Het
Zfp644 T C 5: 106,766,142 (GRCm39) E93G probably damaging Het
Zfp81 C T 17: 33,553,890 (GRCm39) C308Y probably damaging Het
Other mutations in Rhag
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Rhag APN 17 41,122,178 (GRCm39) missense possibly damaging 0.73
IGL01463:Rhag APN 17 41,139,646 (GRCm39) missense probably damaging 1.00
IGL01954:Rhag APN 17 41,139,341 (GRCm39) missense possibly damaging 0.88
IGL03000:Rhag APN 17 41,139,413 (GRCm39) missense probably benign 0.00
R0385:Rhag UTSW 17 41,145,618 (GRCm39) missense probably damaging 0.97
R0570:Rhag UTSW 17 41,139,804 (GRCm39) splice site probably benign
R0811:Rhag UTSW 17 41,142,469 (GRCm39) missense possibly damaging 0.74
R0812:Rhag UTSW 17 41,142,469 (GRCm39) missense possibly damaging 0.74
R1655:Rhag UTSW 17 41,142,487 (GRCm39) missense probably damaging 0.98
R2376:Rhag UTSW 17 41,122,254 (GRCm39) critical splice donor site probably null
R2698:Rhag UTSW 17 41,147,367 (GRCm39) missense probably damaging 0.99
R4695:Rhag UTSW 17 41,147,358 (GRCm39) missense probably damaging 0.99
R4705:Rhag UTSW 17 41,147,329 (GRCm39) missense probably benign 0.35
R4729:Rhag UTSW 17 41,139,292 (GRCm39) missense probably damaging 1.00
R4790:Rhag UTSW 17 41,142,181 (GRCm39) missense probably benign 0.23
R4895:Rhag UTSW 17 41,122,242 (GRCm39) missense probably benign
R5224:Rhag UTSW 17 41,139,395 (GRCm39) missense probably damaging 0.98
R5685:Rhag UTSW 17 41,142,222 (GRCm39) missense possibly damaging 0.88
R7403:Rhag UTSW 17 41,145,549 (GRCm39) missense probably damaging 1.00
R7407:Rhag UTSW 17 41,142,225 (GRCm39) missense possibly damaging 0.56
R7553:Rhag UTSW 17 41,139,286 (GRCm39) missense probably damaging 1.00
R7884:Rhag UTSW 17 41,142,536 (GRCm39) missense probably benign 0.06
R8056:Rhag UTSW 17 41,139,679 (GRCm39) missense probably damaging 1.00
R9135:Rhag UTSW 17 41,139,302 (GRCm39) missense probably damaging 1.00
R9229:Rhag UTSW 17 41,142,081 (GRCm39) missense probably damaging 1.00
R9360:Rhag UTSW 17 41,142,548 (GRCm39) missense possibly damaging 0.82
R9777:Rhag UTSW 17 41,139,416 (GRCm39) missense probably benign 0.02
X0064:Rhag UTSW 17 41,144,396 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TATGGTGGGTCAGTAGTCCC -3'
(R):5'- TTCTGTCTGATTTTAACTGACCAGC -3'

Sequencing Primer
(F):5'- TGCCTCACTTTTTGATGATCAAG -3'
(R):5'- GACCAGCATAAATTACAAAACTGTG -3'
Posted On 2015-06-10