Incidental Mutation 'R4207:Olfr1472'
ID 319001
Institutional Source Beutler Lab
Gene Symbol Olfr1472
Ensembl Gene ENSMUSG00000095189
Gene Name olfactory receptor 1472
Synonyms GA_x6K02T2RE5P-3787124-3786180, MOR202-16
MMRRC Submission 041036-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.194) question?
Stock # R4207 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 13453280-13456086 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 13454471 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 15 (I15M)
Ref Sequence ENSEMBL: ENSMUSP00000093915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077501] [ENSMUST00000096201]
AlphaFold Q7TQQ9
Predicted Effect probably benign
Transcript: ENSMUST00000077501
AA Change: I15M

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000076707
Gene: ENSMUSG00000095189
AA Change: I15M

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.4e-51 PFAM
Pfam:7TM_GPCR_Srsx 33 303 5.2e-8 PFAM
Pfam:7tm_1 39 288 6.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000096201
AA Change: I15M

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000093915
Gene: ENSMUSG00000095189
AA Change: I15M

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 3.9e-53 PFAM
Pfam:7TM_GPCR_Srsx 34 304 2.6e-6 PFAM
Pfam:7tm_1 40 289 1.2e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213561
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b G A 11: 109,981,725 Q17* probably null Het
Acap2 T A 16: 31,119,427 N293I probably damaging Het
Adgrg4 G A X: 56,918,749 V1893I possibly damaging Het
Aff1 T C 5: 103,818,988 probably null Het
Ap1b1 A G 11: 5,031,637 D515G probably damaging Het
Brk1 T C 6: 113,615,844 Y63H possibly damaging Het
Cand1 T C 10: 119,211,845 D580G probably damaging Het
Casp4 A G 9: 5,328,451 D311G probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Ctnnd2 G T 15: 30,972,827 V1033F probably damaging Het
Dhx29 G T 13: 112,927,949 A53S probably benign Het
Dis3 T G 14: 99,095,316 I227L probably benign Het
Efhc2 T C X: 17,230,550 N186S possibly damaging Het
Efl1 T C 7: 82,750,816 V592A probably damaging Het
Elovl7 A T 13: 108,282,506 Q224L possibly damaging Het
Fcgr3 T A 1: 171,054,075 K160N probably benign Het
Flg A G 3: 93,279,862 Y207C probably benign Het
Fmn2 A G 1: 174,581,955 T585A unknown Het
Gm7135 T C 1: 97,469,895 noncoding transcript Het
Gm8104 G T 14: 43,101,634 D94Y probably damaging Het
Hjurp G C 1: 88,277,215 probably benign Het
Ino80b G C 6: 83,122,333 P178R probably damaging Het
Kbtbd4 T C 2: 90,909,755 F495L probably damaging Het
Lingo2 T C 4: 35,709,810 I57V probably benign Het
Me2 T C 18: 73,791,085 K352R probably benign Het
Mthfsd A G 8: 121,105,626 V133A probably damaging Het
Nav2 T A 7: 49,572,298 probably null Het
Nav2 T A 7: 49,597,231 I2168N probably damaging Het
Nlrp10 T A 7: 108,924,341 D644V possibly damaging Het
Olfr148 A G 9: 39,613,957 Y130C possibly damaging Het
Olfr15 T C 16: 3,839,570 L199P probably damaging Het
Oplah C T 15: 76,302,710 R635H probably damaging Het
Peli1 A G 11: 21,147,115 probably null Het
Pfkfb1 A T X: 150,622,188 D208V possibly damaging Het
Pld5 T G 1: 175,993,875 T242P probably damaging Het
Rbm5 A G 9: 107,750,483 S420P probably benign Het
Rhag A T 17: 40,831,653 I250F probably damaging Het
Rnase4 A G 14: 51,105,005 K62R probably benign Het
Scaf4 C T 16: 90,260,215 V83I unknown Het
Slc24a2 A G 4: 87,227,205 V204A probably damaging Het
Slc5a8 G T 10: 88,911,413 L409F probably damaging Het
Spns3 A T 11: 72,538,361 V199E probably damaging Het
Sspo A G 6: 48,478,293 T3030A probably benign Het
Sstr2 A C 11: 113,624,656 T134P probably damaging Het
Stk39 G T 2: 68,220,920 T527K probably benign Het
Sult2a1 T A 7: 13,801,547 T194S probably benign Het
Tamm41 AGGG AGG 6: 115,012,359 probably benign Het
Trav7-3 A G 14: 53,443,746 T82A probably benign Het
Umodl1 G A 17: 30,959,367 V106I probably damaging Het
Vmn2r85 A C 10: 130,418,705 C703W probably damaging Het
Vmn2r92 G A 17: 18,184,261 V556M possibly damaging Het
Zfp292 T C 4: 34,806,079 I2322V probably benign Het
Zfp644 T C 5: 106,618,276 E93G probably damaging Het
Zfp81 C T 17: 33,334,916 C308Y probably damaging Het
Other mutations in Olfr1472
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Olfr1472 APN 19 13453840 missense possibly damaging 0.46
IGL01755:Olfr1472 APN 19 13453815 missense probably damaging 1.00
IGL01885:Olfr1472 APN 19 13454085 missense probably benign 0.00
IGL02366:Olfr1472 APN 19 13454127 missense probably damaging 1.00
IGL03074:Olfr1472 APN 19 13454053 missense probably damaging 0.98
R0592:Olfr1472 UTSW 19 13453705 missense probably benign 0.00
R1085:Olfr1472 UTSW 19 13454230 missense possibly damaging 0.75
R4856:Olfr1472 UTSW 19 13454521 splice site probably null
R4886:Olfr1472 UTSW 19 13454521 splice site probably null
R5061:Olfr1472 UTSW 19 13453985 nonsense probably null
R5167:Olfr1472 UTSW 19 13454377 missense probably damaging 1.00
R5509:Olfr1472 UTSW 19 13453968 missense probably damaging 1.00
R5586:Olfr1472 UTSW 19 13454382 missense probably benign 0.02
R5987:Olfr1472 UTSW 19 13453960 missense possibly damaging 0.57
R6631:Olfr1472 UTSW 19 13453821 missense probably benign 0.00
R7976:Olfr1472 UTSW 19 13454199 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTGAGAAACCCTTCCATCAC -3'
(R):5'- AGTTCCCCAGGATGCATTTAATC -3'

Sequencing Primer
(F):5'- TTCCATCACCTTGGGAGTGACAG -3'
(R):5'- ACAGTGTTCTTCACAAGAAA -3'
Posted On 2015-06-10