Incidental Mutation 'R4208:Olfr1231'
ID319008
Institutional Source Beutler Lab
Gene Symbol Olfr1231
Ensembl Gene ENSMUSG00000075093
Gene Nameolfactory receptor 1231
SynonymsGA_x6K02T2Q125-50748233-50747292, MOR235-2
MMRRC Submission 041037-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R4208 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location89299786-89307074 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89302926 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 222 (I222N)
Ref Sequence ENSEMBL: ENSMUSP00000150310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099786] [ENSMUST00000216144]
Predicted Effect probably damaging
Transcript: ENSMUST00000099786
AA Change: I222N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097374
Gene: ENSMUSG00000075093
AA Change: I222N

DomainStartEndE-ValueType
Pfam:7tm_4 32 306 7e-43 PFAM
Pfam:7tm_1 42 288 1.3e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216144
AA Change: I222N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A T 6: 48,931,647 D527V probably damaging Het
A1cf T C 19: 31,932,660 L284P probably benign Het
Abca8b G A 11: 109,981,725 Q17* probably null Het
Abcc6 A C 7: 45,986,563 L1020R probably damaging Het
Ace2 A G X: 164,169,585 I110V probably benign Het
Adamts12 A G 15: 11,071,754 H128R probably benign Het
Apol9a G C 15: 77,404,396 T257S probably benign Het
B4galnt3 A G 6: 120,215,102 S557P probably damaging Het
C3 C T 17: 57,205,303 D1542N possibly damaging Het
Casp12 T C 9: 5,346,629 L52P probably damaging Het
Cep126 C T 9: 8,100,821 E571K probably damaging Het
Cfhr1 A G 1: 139,547,878 probably benign Het
Cmah A G 13: 24,417,427 probably null Het
Col10a1 C T 10: 34,395,543 P504S probably damaging Het
Ctnna3 T A 10: 64,959,778 D758E probably benign Het
Cyp2c65 T C 19: 39,090,655 S393P probably damaging Het
Dclk2 A G 3: 86,830,822 probably null Het
Dis3 T G 14: 99,095,316 I227L probably benign Het
Efhc2 T C X: 17,230,550 N186S possibly damaging Het
F13b G T 1: 139,516,341 W471L probably damaging Het
Fam181a A G 12: 103,315,914 D26G probably damaging Het
Gabpb2 A G 3: 95,203,934 probably benign Het
Gm7293 A G 9: 51,623,579 noncoding transcript Het
H3f3a C T 1: 180,803,138 R117H probably benign Het
Ino80b G C 6: 83,122,333 P178R probably damaging Het
Kif3b G A 2: 153,323,557 R628Q probably damaging Het
Lars T C 18: 42,229,703 E557G probably benign Het
Ldlrad3 C T 2: 101,953,162 D240N probably damaging Het
Lingo2 T C 4: 35,709,810 I57V probably benign Het
Lsr A G 7: 30,973,094 I27T probably benign Het
Me2 T C 18: 73,791,085 K352R probably benign Het
Met T C 6: 17,548,729 V924A possibly damaging Het
Mpp3 T C 11: 102,000,600 T571A probably benign Het
Olfr665 A G 7: 104,881,603 T299A probably damaging Het
Padi1 C A 4: 140,817,227 V552L possibly damaging Het
Pfkfb1 A T X: 150,622,188 D208V possibly damaging Het
Rnase4 A G 14: 51,105,005 K62R probably benign Het
RP24-126A19.1 C A 5: 146,895,796 R123L noncoding transcript Het
Scn10a T A 9: 119,616,776 E1438V probably damaging Het
Sfmbt2 T A 2: 10,542,982 D458E probably damaging Het
Slitrk3 T A 3: 73,051,157 Y94F possibly damaging Het
Sstr2 A C 11: 113,624,656 T134P probably damaging Het
Steap4 A G 5: 7,980,404 Y420C probably damaging Het
Tamm41 AGGG AGG 6: 115,012,359 probably benign Het
Trav7-3 A G 14: 53,443,746 T82A probably benign Het
Trbv23 A T 6: 41,216,088 I6F probably benign Het
Vmn1r87 A G 7: 13,132,258 V34A probably benign Het
Zc3h7a C T 16: 11,164,644 E6K possibly damaging Het
Zfp606 G A 7: 12,494,175 C683Y probably damaging Het
Other mutations in Olfr1231
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Olfr1231 APN 2 89303472 missense possibly damaging 0.90
IGL02189:Olfr1231 APN 2 89303297 missense probably damaging 1.00
IGL02354:Olfr1231 APN 2 89303182 missense probably benign 0.03
IGL02361:Olfr1231 APN 2 89303182 missense probably benign 0.03
PIT4305001:Olfr1231 UTSW 2 89303383 missense probably benign 0.05
R0973:Olfr1231 UTSW 2 89303184 missense probably damaging 1.00
R0973:Olfr1231 UTSW 2 89303184 missense probably damaging 1.00
R0974:Olfr1231 UTSW 2 89303184 missense probably damaging 1.00
R2006:Olfr1231 UTSW 2 89302816 missense possibly damaging 0.60
R3150:Olfr1231 UTSW 2 89303218 missense possibly damaging 0.82
R3177:Olfr1231 UTSW 2 89303218 missense possibly damaging 0.82
R3277:Olfr1231 UTSW 2 89303218 missense possibly damaging 0.82
R3409:Olfr1231 UTSW 2 89303373 missense probably benign
R4412:Olfr1231 UTSW 2 89303340 missense probably benign 0.00
R4693:Olfr1231 UTSW 2 89303277 missense probably benign 0.07
R4697:Olfr1231 UTSW 2 89302902 missense possibly damaging 0.90
R4697:Olfr1231 UTSW 2 89302903 missense probably damaging 1.00
R5411:Olfr1231 UTSW 2 89303576 missense probably benign
R5992:Olfr1231 UTSW 2 89303359 missense possibly damaging 0.50
R6894:Olfr1231 UTSW 2 89303493 missense probably damaging 1.00
R8019:Olfr1231 UTSW 2 89303251 missense possibly damaging 0.94
X0064:Olfr1231 UTSW 2 89302902 missense possibly damaging 0.72
X0067:Olfr1231 UTSW 2 89303154 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GGGTAAGTGACTTGCCTCTTC -3'
(R):5'- GATTAATCTGCCCTTCTGTGGC -3'

Sequencing Primer
(F):5'- GGTAAGTGACTTGCCTCTTCAATAG -3'
(R):5'- GTGGCCCCAATGTCATTGAC -3'
Posted On2015-06-10