Mutagenetix > Incidental Mutation

Incidental Mutation 'R0394:Greb1l'

31903

Institutional Source

Beutler Lab

Gene Symbol

Greb1l

Ensembl Gene

ENSMUSG00000042942

Gene Name

growth regulation by estrogen in breast cancer-like

Synonyms

AK220484, mKIAA4095

MMRRC Submission

038600-MU

Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0394 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

10325177-10562934 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 10523374 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 844 (V844A)

Ref Sequence

ENSEMBL: ENSMUSP00000049003 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172532] [ENSMUST00000172680]

AlphaFold

B9EJV3

Predicted Effect

probably damaging
Transcript: ENSMUST00000048977
AA Change: V844A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: V844A

Domain	Start	End	E-Value	Type
Pfam:GREB1	1	1172	N/A	PFAM
Pfam:GREB1	1154	1913	N/A	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000172532
AA Change: V735A

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000134090
Gene: ENSMUSG00000042942
AA Change: V735A

Domain	Start	End	E-Value	Type
low complexity region	83	100	N/A	INTRINSIC
low complexity region	282	301	N/A	INTRINSIC
low complexity region	606	617	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000172680

SMART Domains

Protein: ENSMUSP00000134314
Gene: ENSMUSG00000042942

Domain	Start	End	E-Value	Type
low complexity region	116	129	N/A	INTRINSIC

Meta Mutation Damage Score

0.2636

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 92.0%

Validation Efficiency

99% (79/80)

Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	C	A	3: 138,067,304	S751R	probably damaging	Het
4933417A18Rik	T	C	13: 34,932,653		probably benign	Het
Abca8a	A	G	11: 110,026,343	V1610A	probably damaging	Het
Actl10	A	T	2: 154,553,037	H202L	probably benign	Het
Alox12	A	T	11: 70,245,935	V489E	probably damaging	Het
Ap4m1	T	A	5: 138,172,203	F5I	probably benign	Het
Atn1	T	C	6: 124,749,733		probably benign	Het
Atrnl1	T	A	19: 57,673,176	N529K	probably benign	Het
B3gntl1	C	T	11: 121,619,715	G336D	probably damaging	Het
Bmp1	G	A	14: 70,490,034	A703V	probably damaging	Het
Brat1	T	G	5: 140,718,386	L798R	probably damaging	Het
Cacna1c	C	T	6: 118,625,497	G1302R	probably damaging	Het
Cdr2	A	T	7: 120,958,731	D190E	probably benign	Het
Cenpe	T	C	3: 135,216,425		probably benign	Het
Clstn1	A	G	4: 149,644,178	D687G	probably benign	Het
Coro1a	A	G	7: 126,700,640	F337L	probably benign	Het
Ddx49	T	A	8: 70,296,925	I252F	probably damaging	Het
Dennd2a	T	A	6: 39,522,812	D273V	possibly damaging	Het
Derl2	A	T	11: 71,014,561	F32I	probably benign	Het
Dmrta1	A	G	4: 89,692,039	Y412C	probably damaging	Het
Dsg1a	A	G	18: 20,333,750	N559S	probably damaging	Het
Dusp26	G	T	8: 31,091,959	R27L	probably benign	Het
Eif2ak3	T	C	6: 70,885,218	I492T	probably benign	Het
Exoc7	G	T	11: 116,300,398	Q219K	probably damaging	Het
F2r	T	C	13: 95,604,476	T184A	probably damaging	Het
Fbf1	G	A	11: 116,152,462		probably benign	Het
Fbxo28	A	G	1: 182,317,015	M328T	probably benign	Het
Fsip2	T	A	2: 82,991,075	D5717E	possibly damaging	Het
Gnpat	C	A	8: 124,880,225	S373R	possibly damaging	Het
Golgb1	G	T	16: 36,875,579		probably benign	Het
Hps1	G	T	19: 42,770,899		probably null	Het
Inppl1	G	T	7: 101,828,195		probably benign	Het
Isca1	C	T	13: 59,758,885		probably null	Het
Itgb2	T	A	10: 77,542,475	C46S	probably damaging	Het
Kifc5b	C	T	17: 26,923,082	T178M	probably benign	Het
Krt80	T	C	15: 101,352,299	T22A	probably damaging	Het
L3mbtl2	C	T	15: 81,668,741	A125V	probably damaging	Het
Ltbp2	C	T	12: 84,806,424		probably benign	Het
Mettl18	A	G	1: 163,996,341	D77G	probably benign	Het
Mfsd2a	A	G	4: 122,950,168	L336P	probably benign	Het
Mgat4b	A	G	11: 50,230,919		probably null	Het
Mtmr14	C	T	6: 113,280,688	R233*	probably null	Het
Nbea	T	C	3: 56,029,907	Y761C	probably damaging	Het
Neb	A	T	2: 52,177,559		probably null	Het
Nup85	T	G	11: 115,564,531	M1R	probably null	Het
Olfr814	T	A	10: 129,873,942	I272L	probably benign	Het
Oxr1	T	A	15: 41,817,197	M177K	probably damaging	Het
Pgm2l1	A	G	7: 100,252,198	Y98C	probably damaging	Het
Pi4kb	G	T	3: 94,996,804		probably benign	Het
Pi4kb	G	A	3: 94,996,805		probably benign	Het
Pirb	T	A	7: 3,719,248	S199C	probably benign	Het
Prss23	A	C	7: 89,509,847	I338S	probably damaging	Het
Rapgef3	A	T	15: 97,757,819		probably benign	Het
Rdh7	T	A	10: 127,884,670	T278S	probably benign	Het
Rnf219	T	C	14: 104,478,853	R695G	possibly damaging	Het
Rrp1b	A	G	17: 32,058,564	D606G	probably benign	Het
Rxfp1	T	A	3: 79,652,377	Y379F	possibly damaging	Het
Rxfp2	T	C	5: 150,067,388	V514A	probably benign	Het
Scel	A	T	14: 103,562,518	E202V	probably benign	Het
Slc25a36	G	A	9: 97,080,204	A244V	probably benign	Het
Slc2a13	T	G	15: 91,516,392	Q209P	probably damaging	Het
Slc38a6	A	G	12: 73,352,530	N456S	probably benign	Het
Slc6a12	G	T	6: 121,346,998		probably null	Het
Spag6l	T	C	16: 16,780,629	I333V	probably benign	Het
Spen	G	A	4: 141,474,203	A2371V	probably benign	Het
St6galnac1	T	C	11: 116,766,640	D366G	probably damaging	Het
Stk33	T	C	7: 109,341,489	S5G	probably benign	Het
Tle2	T	C	10: 81,577,648	L84P	probably damaging	Het
Tmem14a	T	C	1: 21,226,652	M78T	probably damaging	Het
Top2b	T	A	14: 16,413,556		probably null	Het
Trmt13	A	G	3: 116,582,650	F364S	probably damaging	Het
Unkl	T	A	17: 25,230,777		probably null	Het
Uvrag	A	G	7: 99,004,719		probably benign	Het
Vmn2r8	T	A	5: 108,802,072	N303I	probably benign	Het
Vsig10l	A	G	7: 43,465,455	N360S	probably damaging	Het
Zdhhc25	T	C	15: 88,600,920	Y153H	probably damaging	Het
Zfp646	T	C	7: 127,883,262	V1537A	possibly damaging	Het
Zfp664	T	A	5: 124,886,065	Y174*	probably null	Het

Other mutations in Greb1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00485:Greb1l	APN	18	10555962	missense	possibly damaging	0.90
IGL01554:Greb1l	APN	18	10522144	missense	probably benign	0.01
IGL01563:Greb1l	APN	18	10469399	missense	probably damaging	0.99
IGL01944:Greb1l	APN	18	10557280	missense	possibly damaging	0.91
IGL02110:Greb1l	APN	18	10515271	missense	probably damaging	1.00
IGL02249:Greb1l	APN	18	10532961	missense	probably damaging	1.00
IGL02318:Greb1l	APN	18	10469388	missense	possibly damaging	0.91
IGL02340:Greb1l	APN	18	10515200	missense	probably damaging	0.99
IGL02516:Greb1l	APN	18	10537064	missense	probably benign	0.31
IGL02566:Greb1l	APN	18	10503299	missense	probably damaging	0.99
IGL02583:Greb1l	APN	18	10542362	missense	probably damaging	1.00
IGL02838:Greb1l	APN	18	10560430	missense	probably damaging	1.00
A4554:Greb1l	UTSW	18	10532862	missense	possibly damaging	0.58
PIT4453001:Greb1l	UTSW	18	10533031	missense	probably damaging	0.98
PIT4453001:Greb1l	UTSW	18	10533032	missense	probably benign	0.08
R0099:Greb1l	UTSW	18	10509158	missense	probably damaging	1.00
R0226:Greb1l	UTSW	18	10522076	intron	probably benign
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0239:Greb1l	UTSW	18	10458567	splice site	probably benign
R0316:Greb1l	UTSW	18	10547420	missense	probably damaging	1.00
R0369:Greb1l	UTSW	18	10469375	missense	possibly damaging	0.80
R0478:Greb1l	UTSW	18	10509281	missense	probably damaging	1.00
R0555:Greb1l	UTSW	18	10458781	splice site	probably benign
R0671:Greb1l	UTSW	18	10474303	missense	probably damaging	1.00
R1282:Greb1l	UTSW	18	10547289	missense	probably benign	0.13
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1607:Greb1l	UTSW	18	10529703	missense	possibly damaging	0.85
R1666:Greb1l	UTSW	18	10501080	critical splice donor site	probably null
R1666:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R1720:Greb1l	UTSW	18	10553848	missense	probably benign	0.19
R1808:Greb1l	UTSW	18	10542143	missense	probably benign
R1829:Greb1l	UTSW	18	10509314	missense	probably damaging	1.00
R1897:Greb1l	UTSW	18	10498992	missense	probably benign	0.00
R1967:Greb1l	UTSW	18	10501049	missense	possibly damaging	0.91
R2025:Greb1l	UTSW	18	10515221	missense	possibly damaging	0.71
R2086:Greb1l	UTSW	18	10523281	missense	probably damaging	1.00
R2125:Greb1l	UTSW	18	10511422	missense	probably damaging	0.98
R2139:Greb1l	UTSW	18	10555011	missense	probably damaging	1.00
R2255:Greb1l	UTSW	18	10554857	missense	probably damaging	1.00
R2256:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2257:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2880:Greb1l	UTSW	18	10547288	missense	possibly damaging	0.93
R3623:Greb1l	UTSW	18	10542380	missense	probably damaging	0.99
R3778:Greb1l	UTSW	18	10469444	missense	possibly damaging	0.60
R3975:Greb1l	UTSW	18	10522247	missense	possibly damaging	0.71
R4038:Greb1l	UTSW	18	10515209	missense	possibly damaging	0.93
R4062:Greb1l	UTSW	18	10522150	missense	probably damaging	0.99
R4134:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R4342:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R4409:Greb1l	UTSW	18	10503182	missense	possibly damaging	0.70
R4600:Greb1l	UTSW	18	10553705	missense	probably damaging	1.00
R4618:Greb1l	UTSW	18	10498965	missense	probably benign	0.00
R4683:Greb1l	UTSW	18	10529563	splice site	probably null
R4686:Greb1l	UTSW	18	10522112	missense	probably damaging	0.98
R4707:Greb1l	UTSW	18	10532922	missense	probably benign	0.02
R4780:Greb1l	UTSW	18	10541792	missense	probably benign	0.00
R4819:Greb1l	UTSW	18	10458358	missense	probably damaging	1.00
R4925:Greb1l	UTSW	18	10547447	missense	possibly damaging	0.79
R4960:Greb1l	UTSW	18	10547306	missense	probably damaging	0.99
R5150:Greb1l	UTSW	18	10555950	frame shift	probably null
R5154:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5269:Greb1l	UTSW	18	10511409	missense	probably benign
R5290:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5310:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5328:Greb1l	UTSW	18	10553720	missense	probably damaging	1.00
R5337:Greb1l	UTSW	18	10509143	missense	probably damaging	1.00
R5393:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5402:Greb1l	UTSW	18	10537169	missense	probably benign	0.26
R5718:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5719:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5720:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5721:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5902:Greb1l	UTSW	18	10538302	missense	probably benign	0.00
R5993:Greb1l	UTSW	18	10544455	missense	probably benign	0.10
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6045:Greb1l	UTSW	18	10547068	missense	probably damaging	1.00
R6063:Greb1l	UTSW	18	10557340	missense	probably damaging	1.00
R6297:Greb1l	UTSW	18	10469494	missense	probably damaging	1.00
R6405:Greb1l	UTSW	18	10501076	missense	probably benign	0.30
R6552:Greb1l	UTSW	18	10541814	missense	probably benign	0.00
R6572:Greb1l	UTSW	18	10522131	missense	probably benign	0.07
R6575:Greb1l	UTSW	18	10547347	missense	possibly damaging	0.88
R6922:Greb1l	UTSW	18	10547482	missense	possibly damaging	0.88
R6957:Greb1l	UTSW	18	10558786	missense	probably benign	0.23
R6962:Greb1l	UTSW	18	10547327	missense	probably damaging	1.00
R7012:Greb1l	UTSW	18	10529707	critical splice donor site	probably null
R7179:Greb1l	UTSW	18	10544576	missense	probably benign	0.00
R7251:Greb1l	UTSW	18	10515319	missense	probably damaging	1.00
R7275:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R7301:Greb1l	UTSW	18	10544970	missense	probably damaging	1.00
R7307:Greb1l	UTSW	18	10538142	missense	probably damaging	0.99
R7455:Greb1l	UTSW	18	10554915	missense	probably damaging	1.00
R7832:Greb1l	UTSW	18	10542056	missense	probably benign	0.38
R7934:Greb1l	UTSW	18	10474371	nonsense	probably null
R8137:Greb1l	UTSW	18	10474357	missense	possibly damaging	0.77
R8138:Greb1l	UTSW	18	10533060	missense	probably benign	0.13
R8208:Greb1l	UTSW	18	10510703	missense	probably damaging	1.00
R8227:Greb1l	UTSW	18	10515371	missense	probably damaging	1.00
R8312:Greb1l	UTSW	18	10511587	intron	probably benign
R8331:Greb1l	UTSW	18	10458706	missense	possibly damaging	0.96
R8364:Greb1l	UTSW	18	10529687	missense	possibly damaging	0.85
R8389:Greb1l	UTSW	18	10529613	missense	probably benign	0.00
R8695:Greb1l	UTSW	18	10544450	missense	probably benign	0.01
R8795:Greb1l	UTSW	18	10553739	missense	probably damaging	0.98
R8836:Greb1l	UTSW	18	10509257	missense	probably benign	0.30
R8862:Greb1l	UTSW	18	10555042	missense	possibly damaging	0.90
R8872:Greb1l	UTSW	18	10529684	missense	probably benign	0.18
R8874:Greb1l	UTSW	18	10544896	missense	probably benign	0.01
R8886:Greb1l	UTSW	18	10553843	missense	probably benign	0.21
R8921:Greb1l	UTSW	18	10541825	missense	probably benign	0.01
R8997:Greb1l	UTSW	18	10510747	missense	probably damaging	1.00
R9015:Greb1l	UTSW	18	10541675	missense	probably benign	0.00
R9018:Greb1l	UTSW	18	10542004	missense	possibly damaging	0.76
R9074:Greb1l	UTSW	18	10532797	missense	probably damaging	1.00
R9074:Greb1l	UTSW	18	10558795	missense	probably damaging	1.00
R9117:Greb1l	UTSW	18	10542422	missense	probably benign	0.31
R9189:Greb1l	UTSW	18	10499983	missense	probably benign
R9332:Greb1l	UTSW	18	10532796	missense	possibly damaging	0.92
R9367:Greb1l	UTSW	18	10522130	missense	probably benign	0.00
R9497:Greb1l	UTSW	18	10458600	missense	probably benign	0.00
Z1176:Greb1l	UTSW	18	10515305	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCCACAGTGTGATTTCAGGCTCTC -3'
(R):5'- TAGTTCACCATTCACCCGTGCCAG -3'

Sequencing Primer
(F):5'- TCTGTCACATGGTGAGCCAAC -3'
(R):5'- GTGCCAGTGTCATAATCATTGC -3'

Posted On

2013-04-24