Incidental Mutation 'R0394:Greb1l'
ID 31903
Institutional Source Beutler Lab
Gene Symbol Greb1l
Ensembl Gene ENSMUSG00000042942
Gene Name growth regulation by estrogen in breast cancer-like
Synonyms AK220484, mKIAA4095
MMRRC Submission 038600-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0394 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 10325177-10562934 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 10523374 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 844 (V844A)
Ref Sequence ENSEMBL: ENSMUSP00000049003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172532] [ENSMUST00000172680]
AlphaFold B9EJV3
Predicted Effect probably damaging
Transcript: ENSMUST00000048977
AA Change: V844A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: V844A

DomainStartEndE-ValueType
Pfam:GREB1 1 1172 N/A PFAM
Pfam:GREB1 1154 1913 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000172532
AA Change: V735A

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000134090
Gene: ENSMUSG00000042942
AA Change: V735A

DomainStartEndE-ValueType
low complexity region 83 100 N/A INTRINSIC
low complexity region 282 301 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172680
SMART Domains Protein: ENSMUSP00000134314
Gene: ENSMUSG00000042942

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
Meta Mutation Damage Score 0.2636 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency 99% (79/80)
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C A 3: 138,067,304 (GRCm38) S751R probably damaging Het
4933417A18Rik T C 13: 34,932,653 (GRCm38) probably benign Het
Abca8a A G 11: 110,026,343 (GRCm38) V1610A probably damaging Het
Actl10 A T 2: 154,553,037 (GRCm38) H202L probably benign Het
Alox12 A T 11: 70,245,935 (GRCm38) V489E probably damaging Het
Ap4m1 T A 5: 138,172,203 (GRCm38) F5I probably benign Het
Atn1 T C 6: 124,749,733 (GRCm38) probably benign Het
Atrnl1 T A 19: 57,673,176 (GRCm38) N529K probably benign Het
B3gntl1 C T 11: 121,619,715 (GRCm38) G336D probably damaging Het
Bmp1 G A 14: 70,490,034 (GRCm38) A703V probably damaging Het
Brat1 T G 5: 140,718,386 (GRCm38) L798R probably damaging Het
Cacna1c C T 6: 118,625,497 (GRCm38) G1302R probably damaging Het
Cdr2 A T 7: 120,958,731 (GRCm38) D190E probably benign Het
Cenpe T C 3: 135,216,425 (GRCm38) probably benign Het
Clstn1 A G 4: 149,644,178 (GRCm38) D687G probably benign Het
Coro1a A G 7: 126,700,640 (GRCm38) F337L probably benign Het
Ddx49 T A 8: 70,296,925 (GRCm38) I252F probably damaging Het
Dennd2a T A 6: 39,522,812 (GRCm38) D273V possibly damaging Het
Derl2 A T 11: 71,014,561 (GRCm38) F32I probably benign Het
Dmrta1 A G 4: 89,692,039 (GRCm38) Y412C probably damaging Het
Dsg1a A G 18: 20,333,750 (GRCm38) N559S probably damaging Het
Dusp26 G T 8: 31,091,959 (GRCm38) R27L probably benign Het
Eif2ak3 T C 6: 70,885,218 (GRCm38) I492T probably benign Het
Exoc7 G T 11: 116,300,398 (GRCm38) Q219K probably damaging Het
F2r T C 13: 95,604,476 (GRCm38) T184A probably damaging Het
Fbf1 G A 11: 116,152,462 (GRCm38) probably benign Het
Fbxo28 A G 1: 182,317,015 (GRCm38) M328T probably benign Het
Fsip2 T A 2: 82,991,075 (GRCm38) D5717E possibly damaging Het
Gnpat C A 8: 124,880,225 (GRCm38) S373R possibly damaging Het
Golgb1 G T 16: 36,875,579 (GRCm38) probably benign Het
Hps1 G T 19: 42,770,899 (GRCm38) probably null Het
Inppl1 G T 7: 101,828,195 (GRCm38) probably benign Het
Isca1 C T 13: 59,758,885 (GRCm38) probably null Het
Itgb2 T A 10: 77,542,475 (GRCm38) C46S probably damaging Het
Kifc5b C T 17: 26,923,082 (GRCm38) T178M probably benign Het
Krt80 T C 15: 101,352,299 (GRCm38) T22A probably damaging Het
L3mbtl2 C T 15: 81,668,741 (GRCm38) A125V probably damaging Het
Ltbp2 C T 12: 84,806,424 (GRCm38) probably benign Het
Mettl18 A G 1: 163,996,341 (GRCm38) D77G probably benign Het
Mfsd2a A G 4: 122,950,168 (GRCm38) L336P probably benign Het
Mgat4b A G 11: 50,230,919 (GRCm38) probably null Het
Mtmr14 C T 6: 113,280,688 (GRCm38) R233* probably null Het
Nbea T C 3: 56,029,907 (GRCm38) Y761C probably damaging Het
Neb A T 2: 52,177,559 (GRCm38) probably null Het
Nup85 T G 11: 115,564,531 (GRCm38) M1R probably null Het
Olfr814 T A 10: 129,873,942 (GRCm38) I272L probably benign Het
Oxr1 T A 15: 41,817,197 (GRCm38) M177K probably damaging Het
Pgm2l1 A G 7: 100,252,198 (GRCm38) Y98C probably damaging Het
Pi4kb G T 3: 94,996,804 (GRCm38) probably benign Het
Pi4kb G A 3: 94,996,805 (GRCm38) probably benign Het
Pirb T A 7: 3,719,248 (GRCm38) S199C probably benign Het
Prss23 A C 7: 89,509,847 (GRCm38) I338S probably damaging Het
Rapgef3 A T 15: 97,757,819 (GRCm38) probably benign Het
Rdh7 T A 10: 127,884,670 (GRCm38) T278S probably benign Het
Rnf219 T C 14: 104,478,853 (GRCm38) R695G possibly damaging Het
Rrp1b A G 17: 32,058,564 (GRCm38) D606G probably benign Het
Rxfp1 T A 3: 79,652,377 (GRCm38) Y379F possibly damaging Het
Rxfp2 T C 5: 150,067,388 (GRCm38) V514A probably benign Het
Scel A T 14: 103,562,518 (GRCm38) E202V probably benign Het
Slc25a36 G A 9: 97,080,204 (GRCm38) A244V probably benign Het
Slc2a13 T G 15: 91,516,392 (GRCm38) Q209P probably damaging Het
Slc38a6 A G 12: 73,352,530 (GRCm38) N456S probably benign Het
Slc6a12 G T 6: 121,346,998 (GRCm38) probably null Het
Spag6l T C 16: 16,780,629 (GRCm38) I333V probably benign Het
Spen G A 4: 141,474,203 (GRCm38) A2371V probably benign Het
St6galnac1 T C 11: 116,766,640 (GRCm38) D366G probably damaging Het
Stk33 T C 7: 109,341,489 (GRCm38) S5G probably benign Het
Tle2 T C 10: 81,577,648 (GRCm38) L84P probably damaging Het
Tmem14a T C 1: 21,226,652 (GRCm38) M78T probably damaging Het
Top2b T A 14: 16,413,556 (GRCm38) probably null Het
Trmt13 A G 3: 116,582,650 (GRCm38) F364S probably damaging Het
Unkl T A 17: 25,230,777 (GRCm38) probably null Het
Uvrag A G 7: 99,004,719 (GRCm38) probably benign Het
Vmn2r8 T A 5: 108,802,072 (GRCm38) N303I probably benign Het
Vsig10l A G 7: 43,465,455 (GRCm38) N360S probably damaging Het
Zdhhc25 T C 15: 88,600,920 (GRCm38) Y153H probably damaging Het
Zfp646 T C 7: 127,883,262 (GRCm38) V1537A possibly damaging Het
Zfp664 T A 5: 124,886,065 (GRCm38) Y174* probably null Het
Other mutations in Greb1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Greb1l APN 18 10,555,962 (GRCm38) missense possibly damaging 0.90
IGL01554:Greb1l APN 18 10,522,144 (GRCm38) missense probably benign 0.01
IGL01563:Greb1l APN 18 10,469,399 (GRCm38) missense probably damaging 0.99
IGL01944:Greb1l APN 18 10,557,280 (GRCm38) missense possibly damaging 0.91
IGL02110:Greb1l APN 18 10,515,271 (GRCm38) missense probably damaging 1.00
IGL02249:Greb1l APN 18 10,532,961 (GRCm38) missense probably damaging 1.00
IGL02318:Greb1l APN 18 10,469,388 (GRCm38) missense possibly damaging 0.91
IGL02340:Greb1l APN 18 10,515,200 (GRCm38) missense probably damaging 0.99
IGL02516:Greb1l APN 18 10,537,064 (GRCm38) missense probably benign 0.31
IGL02566:Greb1l APN 18 10,503,299 (GRCm38) missense probably damaging 0.99
IGL02583:Greb1l APN 18 10,542,362 (GRCm38) missense probably damaging 1.00
IGL02838:Greb1l APN 18 10,560,430 (GRCm38) missense probably damaging 1.00
A4554:Greb1l UTSW 18 10,532,862 (GRCm38) missense possibly damaging 0.58
PIT4453001:Greb1l UTSW 18 10,533,032 (GRCm38) missense probably benign 0.08
PIT4453001:Greb1l UTSW 18 10,533,031 (GRCm38) missense probably damaging 0.98
R0099:Greb1l UTSW 18 10,509,158 (GRCm38) missense probably damaging 1.00
R0226:Greb1l UTSW 18 10,522,076 (GRCm38) intron probably benign
R0234:Greb1l UTSW 18 10,560,331 (GRCm38) missense probably damaging 1.00
R0234:Greb1l UTSW 18 10,560,331 (GRCm38) missense probably damaging 1.00
R0239:Greb1l UTSW 18 10,458,567 (GRCm38) splice site probably benign
R0316:Greb1l UTSW 18 10,547,420 (GRCm38) missense probably damaging 1.00
R0369:Greb1l UTSW 18 10,469,375 (GRCm38) missense possibly damaging 0.80
R0478:Greb1l UTSW 18 10,509,281 (GRCm38) missense probably damaging 1.00
R0555:Greb1l UTSW 18 10,458,781 (GRCm38) splice site probably benign
R0671:Greb1l UTSW 18 10,474,303 (GRCm38) missense probably damaging 1.00
R1282:Greb1l UTSW 18 10,547,289 (GRCm38) missense probably benign 0.13
R1574:Greb1l UTSW 18 10,554,997 (GRCm38) missense possibly damaging 0.95
R1574:Greb1l UTSW 18 10,554,997 (GRCm38) missense possibly damaging 0.95
R1607:Greb1l UTSW 18 10,529,703 (GRCm38) missense possibly damaging 0.85
R1666:Greb1l UTSW 18 10,529,708 (GRCm38) critical splice donor site probably null
R1666:Greb1l UTSW 18 10,501,080 (GRCm38) critical splice donor site probably null
R1720:Greb1l UTSW 18 10,553,848 (GRCm38) missense probably benign 0.19
R1808:Greb1l UTSW 18 10,542,143 (GRCm38) missense probably benign
R1829:Greb1l UTSW 18 10,509,314 (GRCm38) missense probably damaging 1.00
R1897:Greb1l UTSW 18 10,498,992 (GRCm38) missense probably benign 0.00
R1967:Greb1l UTSW 18 10,501,049 (GRCm38) missense possibly damaging 0.91
R2025:Greb1l UTSW 18 10,515,221 (GRCm38) missense possibly damaging 0.71
R2086:Greb1l UTSW 18 10,523,281 (GRCm38) missense probably damaging 1.00
R2125:Greb1l UTSW 18 10,511,422 (GRCm38) missense probably damaging 0.98
R2139:Greb1l UTSW 18 10,555,011 (GRCm38) missense probably damaging 1.00
R2255:Greb1l UTSW 18 10,554,857 (GRCm38) missense probably damaging 1.00
R2256:Greb1l UTSW 18 10,503,307 (GRCm38) missense possibly damaging 0.91
R2257:Greb1l UTSW 18 10,503,307 (GRCm38) missense possibly damaging 0.91
R2880:Greb1l UTSW 18 10,547,288 (GRCm38) missense possibly damaging 0.93
R3623:Greb1l UTSW 18 10,542,380 (GRCm38) missense probably damaging 0.99
R3778:Greb1l UTSW 18 10,469,444 (GRCm38) missense possibly damaging 0.60
R3975:Greb1l UTSW 18 10,522,247 (GRCm38) missense possibly damaging 0.71
R4038:Greb1l UTSW 18 10,515,209 (GRCm38) missense possibly damaging 0.93
R4062:Greb1l UTSW 18 10,522,150 (GRCm38) missense probably damaging 0.99
R4134:Greb1l UTSW 18 10,529,708 (GRCm38) critical splice donor site probably null
R4342:Greb1l UTSW 18 10,544,561 (GRCm38) missense probably benign 0.12
R4409:Greb1l UTSW 18 10,503,182 (GRCm38) missense possibly damaging 0.70
R4600:Greb1l UTSW 18 10,553,705 (GRCm38) missense probably damaging 1.00
R4618:Greb1l UTSW 18 10,498,965 (GRCm38) missense probably benign 0.00
R4683:Greb1l UTSW 18 10,529,563 (GRCm38) splice site probably null
R4686:Greb1l UTSW 18 10,522,112 (GRCm38) missense probably damaging 0.98
R4707:Greb1l UTSW 18 10,532,922 (GRCm38) missense probably benign 0.02
R4780:Greb1l UTSW 18 10,541,792 (GRCm38) missense probably benign 0.00
R4819:Greb1l UTSW 18 10,458,358 (GRCm38) missense probably damaging 1.00
R4925:Greb1l UTSW 18 10,547,447 (GRCm38) missense possibly damaging 0.79
R4960:Greb1l UTSW 18 10,547,306 (GRCm38) missense probably damaging 0.99
R5150:Greb1l UTSW 18 10,555,950 (GRCm38) frame shift probably null
R5154:Greb1l UTSW 18 10,458,312 (GRCm38) missense probably benign 0.02
R5269:Greb1l UTSW 18 10,511,409 (GRCm38) missense probably benign
R5290:Greb1l UTSW 18 10,542,427 (GRCm38) missense probably damaging 1.00
R5310:Greb1l UTSW 18 10,542,427 (GRCm38) missense probably damaging 1.00
R5328:Greb1l UTSW 18 10,553,720 (GRCm38) missense probably damaging 1.00
R5337:Greb1l UTSW 18 10,509,143 (GRCm38) missense probably damaging 1.00
R5393:Greb1l UTSW 18 10,458,312 (GRCm38) missense probably benign 0.02
R5402:Greb1l UTSW 18 10,537,169 (GRCm38) missense probably benign 0.26
R5718:Greb1l UTSW 18 10,542,427 (GRCm38) missense probably damaging 1.00
R5719:Greb1l UTSW 18 10,542,427 (GRCm38) missense probably damaging 1.00
R5720:Greb1l UTSW 18 10,542,427 (GRCm38) missense probably damaging 1.00
R5721:Greb1l UTSW 18 10,542,427 (GRCm38) missense probably damaging 1.00
R5902:Greb1l UTSW 18 10,538,302 (GRCm38) missense probably benign 0.00
R5993:Greb1l UTSW 18 10,544,455 (GRCm38) missense probably benign 0.10
R6035:Greb1l UTSW 18 10,501,025 (GRCm38) missense possibly damaging 0.91
R6035:Greb1l UTSW 18 10,501,025 (GRCm38) missense possibly damaging 0.91
R6045:Greb1l UTSW 18 10,547,068 (GRCm38) missense probably damaging 1.00
R6063:Greb1l UTSW 18 10,557,340 (GRCm38) missense probably damaging 1.00
R6297:Greb1l UTSW 18 10,469,494 (GRCm38) missense probably damaging 1.00
R6405:Greb1l UTSW 18 10,501,076 (GRCm38) missense probably benign 0.30
R6552:Greb1l UTSW 18 10,541,814 (GRCm38) missense probably benign 0.00
R6572:Greb1l UTSW 18 10,522,131 (GRCm38) missense probably benign 0.07
R6575:Greb1l UTSW 18 10,547,347 (GRCm38) missense possibly damaging 0.88
R6922:Greb1l UTSW 18 10,547,482 (GRCm38) missense possibly damaging 0.88
R6957:Greb1l UTSW 18 10,558,786 (GRCm38) missense probably benign 0.23
R6962:Greb1l UTSW 18 10,547,327 (GRCm38) missense probably damaging 1.00
R7012:Greb1l UTSW 18 10,529,707 (GRCm38) critical splice donor site probably null
R7179:Greb1l UTSW 18 10,544,576 (GRCm38) missense probably benign 0.00
R7251:Greb1l UTSW 18 10,515,319 (GRCm38) missense probably damaging 1.00
R7275:Greb1l UTSW 18 10,544,561 (GRCm38) missense probably benign 0.12
R7301:Greb1l UTSW 18 10,544,970 (GRCm38) missense probably damaging 1.00
R7307:Greb1l UTSW 18 10,538,142 (GRCm38) missense probably damaging 0.99
R7455:Greb1l UTSW 18 10,554,915 (GRCm38) missense probably damaging 1.00
R7832:Greb1l UTSW 18 10,542,056 (GRCm38) missense probably benign 0.38
R7934:Greb1l UTSW 18 10,474,371 (GRCm38) nonsense probably null
R8137:Greb1l UTSW 18 10,474,357 (GRCm38) missense possibly damaging 0.77
R8138:Greb1l UTSW 18 10,533,060 (GRCm38) missense probably benign 0.13
R8208:Greb1l UTSW 18 10,510,703 (GRCm38) missense probably damaging 1.00
R8227:Greb1l UTSW 18 10,515,371 (GRCm38) missense probably damaging 1.00
R8312:Greb1l UTSW 18 10,511,587 (GRCm38) intron probably benign
R8331:Greb1l UTSW 18 10,458,706 (GRCm38) missense possibly damaging 0.96
R8364:Greb1l UTSW 18 10,529,687 (GRCm38) missense possibly damaging 0.85
R8389:Greb1l UTSW 18 10,529,613 (GRCm38) missense probably benign 0.00
R8695:Greb1l UTSW 18 10,544,450 (GRCm38) missense probably benign 0.01
R8795:Greb1l UTSW 18 10,553,739 (GRCm38) missense probably damaging 0.98
R8836:Greb1l UTSW 18 10,509,257 (GRCm38) missense probably benign 0.30
R8862:Greb1l UTSW 18 10,555,042 (GRCm38) missense possibly damaging 0.90
R8872:Greb1l UTSW 18 10,529,684 (GRCm38) missense probably benign 0.18
R8874:Greb1l UTSW 18 10,544,896 (GRCm38) missense probably benign 0.01
R8886:Greb1l UTSW 18 10,553,843 (GRCm38) missense probably benign 0.21
R8921:Greb1l UTSW 18 10,541,825 (GRCm38) missense probably benign 0.01
R8997:Greb1l UTSW 18 10,510,747 (GRCm38) missense probably damaging 1.00
R9015:Greb1l UTSW 18 10,541,675 (GRCm38) missense probably benign 0.00
R9018:Greb1l UTSW 18 10,542,004 (GRCm38) missense possibly damaging 0.76
R9074:Greb1l UTSW 18 10,558,795 (GRCm38) missense probably damaging 1.00
R9074:Greb1l UTSW 18 10,532,797 (GRCm38) missense probably damaging 1.00
R9117:Greb1l UTSW 18 10,542,422 (GRCm38) missense probably benign 0.31
R9189:Greb1l UTSW 18 10,499,983 (GRCm38) missense probably benign
R9332:Greb1l UTSW 18 10,532,796 (GRCm38) missense possibly damaging 0.92
R9367:Greb1l UTSW 18 10,522,130 (GRCm38) missense probably benign 0.00
R9497:Greb1l UTSW 18 10,458,600 (GRCm38) missense probably benign 0.00
R9796:Greb1l UTSW 18 10,538,233 (GRCm38) missense possibly damaging 0.69
Z1176:Greb1l UTSW 18 10,515,305 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCACAGTGTGATTTCAGGCTCTC -3'
(R):5'- TAGTTCACCATTCACCCGTGCCAG -3'

Sequencing Primer
(F):5'- TCTGTCACATGGTGAGCCAAC -3'
(R):5'- GTGCCAGTGTCATAATCATTGC -3'
Posted On 2013-04-24