Incidental Mutation 'R4208:Adamts12'
ID 319044
Institutional Source Beutler Lab
Gene Symbol Adamts12
Ensembl Gene ENSMUSG00000047497
Gene Name ADAM metallopeptidase with thrombospondin type 1 motif 12
Synonyms
MMRRC Submission 041037-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R4208 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 11064876-11349317 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 11071840 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 128 (H128R)
Ref Sequence ENSEMBL: ENSMUSP00000057796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061318]
AlphaFold Q811B3
Predicted Effect probably benign
Transcript: ENSMUST00000061318
AA Change: H128R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000057796
Gene: ENSMUSG00000047497
AA Change: H128R

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Pep_M12B_propep 53 197 5.5e-30 PFAM
low complexity region 236 245 N/A INTRINSIC
Pfam:Reprolysin_5 248 438 1.6e-14 PFAM
Pfam:Reprolysin_4 248 453 6.7e-8 PFAM
Pfam:Reprolysin 250 460 1.2e-27 PFAM
Pfam:Reprolysin_2 268 450 5.5e-11 PFAM
Pfam:Reprolysin_3 272 407 3.5e-10 PFAM
TSP1 549 601 9.29e-14 SMART
Pfam:ADAM_spacer1 706 817 4.8e-36 PFAM
TSP1 831 887 4.66e-5 SMART
TSP1 890 949 2.54e-1 SMART
TSP1 951 1001 8.95e-7 SMART
low complexity region 1032 1047 N/A INTRINSIC
low complexity region 1130 1141 N/A INTRINSIC
TSP1 1321 1371 2.22e-2 SMART
TSP1 1372 1431 9.97e-2 SMART
TSP1 1432 1479 1.19e-2 SMART
TSP1 1480 1538 2.63e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227189
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228940
Meta Mutation Damage Score 0.0707 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active protease. Mice lacking the encoded protein exhibit increased angiogenic response and tumor invasion in different models of angiogenesis and, severe inflammation and delayed recovery when subjected to experimental conditions that induce colitis, endotoxic sepsis and pancreatitis. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased tumor vascularization, tumor invasion, and angiogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T C 19: 31,910,060 (GRCm39) L284P probably benign Het
Abca8b G A 11: 109,872,551 (GRCm39) Q17* probably null Het
Abcc6 A C 7: 45,635,987 (GRCm39) L1020R probably damaging Het
Ace2 A G X: 162,952,581 (GRCm39) I110V probably benign Het
Aoc1l2 A T 6: 48,908,581 (GRCm39) D527V probably damaging Het
Apol9a G C 15: 77,288,596 (GRCm39) T257S probably benign Het
B4galnt3 A G 6: 120,192,063 (GRCm39) S557P probably damaging Het
C3 C T 17: 57,512,303 (GRCm39) D1542N possibly damaging Het
Casp12 T C 9: 5,346,629 (GRCm39) L52P probably damaging Het
Cep126 C T 9: 8,100,822 (GRCm39) E571K probably damaging Het
Cfhr1 A G 1: 139,475,616 (GRCm39) probably benign Het
Cmah A G 13: 24,601,410 (GRCm39) probably null Het
Col10a1 C T 10: 34,271,539 (GRCm39) P504S probably damaging Het
Ctnna3 T A 10: 64,795,557 (GRCm39) D758E probably benign Het
Cyp2c65 T C 19: 39,079,099 (GRCm39) S393P probably damaging Het
Dclk2 A G 3: 86,738,129 (GRCm39) probably null Het
Dis3 T G 14: 99,332,752 (GRCm39) I227L probably benign Het
Efhc2 T C X: 17,096,789 (GRCm39) N186S possibly damaging Het
F13b G T 1: 139,444,079 (GRCm39) W471L probably damaging Het
Fam181a A G 12: 103,282,173 (GRCm39) D26G probably damaging Het
Gabpb2 A G 3: 95,111,245 (GRCm39) probably benign Het
Gm7293 A G 9: 51,534,879 (GRCm39) noncoding transcript Het
H3f3a C T 1: 180,630,703 (GRCm39) R117H probably benign Het
Ino80b G C 6: 83,099,314 (GRCm39) P178R probably damaging Het
Kif3b G A 2: 153,165,477 (GRCm39) R628Q probably damaging Het
Lars1 T C 18: 42,362,768 (GRCm39) E557G probably benign Het
Ldlrad3 C T 2: 101,783,507 (GRCm39) D240N probably damaging Het
Lingo2 T C 4: 35,709,810 (GRCm39) I57V probably benign Het
Lsr A G 7: 30,672,519 (GRCm39) I27T probably benign Het
Me2 T C 18: 73,924,156 (GRCm39) K352R probably benign Het
Met T C 6: 17,548,728 (GRCm39) V924A possibly damaging Het
Mpp3 T C 11: 101,891,426 (GRCm39) T571A probably benign Het
Or4c1 A T 2: 89,133,270 (GRCm39) I222N probably damaging Het
Or52n3 A G 7: 104,530,810 (GRCm39) T299A probably damaging Het
Padi1 C A 4: 140,544,538 (GRCm39) V552L possibly damaging Het
Pfkfb1 A T X: 149,405,184 (GRCm39) D208V possibly damaging Het
Rnase4 A G 14: 51,342,462 (GRCm39) K62R probably benign Het
RP24-126A19.1 C A 5: 146,832,606 (GRCm39) R123L noncoding transcript Het
Scn10a T A 9: 119,445,842 (GRCm39) E1438V probably damaging Het
Sfmbt2 T A 2: 10,547,793 (GRCm39) D458E probably damaging Het
Slitrk3 T A 3: 72,958,490 (GRCm39) Y94F possibly damaging Het
Sstr2 A C 11: 113,515,482 (GRCm39) T134P probably damaging Het
Steap4 A G 5: 8,030,404 (GRCm39) Y420C probably damaging Het
Tamm41 AGGG AGG 6: 114,989,320 (GRCm39) probably benign Het
Trav7-3 A G 14: 53,681,203 (GRCm39) T82A probably benign Het
Trbv23 A T 6: 41,193,022 (GRCm39) I6F probably benign Het
Vmn1r87 A G 7: 12,866,185 (GRCm39) V34A probably benign Het
Zc3h7a C T 16: 10,982,508 (GRCm39) E6K possibly damaging Het
Zfp606 G A 7: 12,228,102 (GRCm39) C683Y probably damaging Het
Other mutations in Adamts12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Adamts12 APN 15 11,311,685 (GRCm39) missense probably benign 0.00
IGL00513:Adamts12 APN 15 11,257,047 (GRCm39) missense probably benign 0.28
IGL00579:Adamts12 APN 15 11,152,100 (GRCm39) missense probably benign 0.20
IGL00984:Adamts12 APN 15 11,215,696 (GRCm39) missense probably benign 0.01
IGL01307:Adamts12 APN 15 11,237,632 (GRCm39) missense possibly damaging 0.88
IGL01314:Adamts12 APN 15 11,071,939 (GRCm39) missense probably benign 0.30
IGL01353:Adamts12 APN 15 11,292,091 (GRCm39) splice site probably benign
IGL01373:Adamts12 APN 15 11,310,816 (GRCm39) missense probably benign 0.00
IGL01522:Adamts12 APN 15 11,065,245 (GRCm39) critical splice donor site probably null
IGL01589:Adamts12 APN 15 11,311,323 (GRCm39) missense probably benign 0.26
IGL01715:Adamts12 APN 15 11,258,182 (GRCm39) missense possibly damaging 0.47
IGL01966:Adamts12 APN 15 11,258,269 (GRCm39) missense probably damaging 0.98
IGL01994:Adamts12 APN 15 11,345,680 (GRCm39) missense probably damaging 1.00
IGL02058:Adamts12 APN 15 11,215,696 (GRCm39) missense probably benign 0.01
IGL02216:Adamts12 APN 15 11,241,571 (GRCm39) missense possibly damaging 0.63
IGL02252:Adamts12 APN 15 11,311,101 (GRCm39) missense probably benign 0.01
IGL02336:Adamts12 APN 15 11,311,331 (GRCm39) missense probably benign 0.02
IGL02445:Adamts12 APN 15 11,286,798 (GRCm39) missense probably damaging 1.00
IGL03115:Adamts12 APN 15 11,263,422 (GRCm39) missense probably damaging 1.00
IGL03131:Adamts12 APN 15 11,345,650 (GRCm39) missense probably damaging 1.00
IGL03161:Adamts12 APN 15 11,292,168 (GRCm39) missense possibly damaging 0.93
IGL03403:Adamts12 APN 15 11,241,574 (GRCm39) missense probably damaging 1.00
I2289:Adamts12 UTSW 15 11,071,894 (GRCm39) missense probably benign 0.13
PIT4677001:Adamts12 UTSW 15 11,286,896 (GRCm39) missense probably benign 0.33
R0016:Adamts12 UTSW 15 11,217,915 (GRCm39) missense probably damaging 1.00
R0016:Adamts12 UTSW 15 11,217,915 (GRCm39) missense probably damaging 1.00
R0027:Adamts12 UTSW 15 11,285,959 (GRCm39) missense probably damaging 0.99
R0027:Adamts12 UTSW 15 11,285,959 (GRCm39) missense probably damaging 0.99
R0028:Adamts12 UTSW 15 11,215,710 (GRCm39) missense probably damaging 1.00
R0108:Adamts12 UTSW 15 11,311,184 (GRCm39) missense probably benign 0.08
R0108:Adamts12 UTSW 15 11,311,184 (GRCm39) missense probably benign 0.08
R0122:Adamts12 UTSW 15 11,215,710 (GRCm39) missense probably damaging 1.00
R0196:Adamts12 UTSW 15 11,071,594 (GRCm39) missense probably benign 0.11
R0308:Adamts12 UTSW 15 11,311,646 (GRCm39) missense probably damaging 0.98
R0335:Adamts12 UTSW 15 11,311,144 (GRCm39) missense possibly damaging 0.95
R0667:Adamts12 UTSW 15 11,215,710 (GRCm39) missense probably damaging 1.00
R0729:Adamts12 UTSW 15 11,255,769 (GRCm39) missense possibly damaging 0.91
R1162:Adamts12 UTSW 15 11,277,544 (GRCm39) critical splice donor site probably null
R1173:Adamts12 UTSW 15 11,071,843 (GRCm39) missense probably benign
R1174:Adamts12 UTSW 15 11,071,843 (GRCm39) missense probably benign
R1319:Adamts12 UTSW 15 11,286,877 (GRCm39) missense probably benign 0.02
R1344:Adamts12 UTSW 15 11,286,890 (GRCm39) missense probably damaging 1.00
R1367:Adamts12 UTSW 15 11,256,980 (GRCm39) splice site probably benign
R1396:Adamts12 UTSW 15 11,311,558 (GRCm39) missense probably benign 0.01
R1418:Adamts12 UTSW 15 11,286,890 (GRCm39) missense probably damaging 1.00
R1447:Adamts12 UTSW 15 11,263,447 (GRCm39) missense probably benign 0.42
R1466:Adamts12 UTSW 15 11,311,445 (GRCm39) missense probably benign
R1466:Adamts12 UTSW 15 11,311,445 (GRCm39) missense probably benign
R1599:Adamts12 UTSW 15 11,071,797 (GRCm39) missense probably damaging 0.99
R1700:Adamts12 UTSW 15 11,152,143 (GRCm39) missense probably benign 0.00
R1748:Adamts12 UTSW 15 11,241,548 (GRCm39) missense probably damaging 0.99
R1826:Adamts12 UTSW 15 11,071,606 (GRCm39) missense probably benign 0.06
R1870:Adamts12 UTSW 15 11,311,240 (GRCm39) missense probably benign 0.06
R1871:Adamts12 UTSW 15 11,311,240 (GRCm39) missense probably benign 0.06
R1872:Adamts12 UTSW 15 11,217,966 (GRCm39) nonsense probably null
R1931:Adamts12 UTSW 15 11,270,685 (GRCm39) missense probably benign 0.00
R2041:Adamts12 UTSW 15 11,215,821 (GRCm39) missense probably damaging 1.00
R2119:Adamts12 UTSW 15 11,310,665 (GRCm39) missense probably damaging 1.00
R2120:Adamts12 UTSW 15 11,310,665 (GRCm39) missense probably damaging 1.00
R2122:Adamts12 UTSW 15 11,310,665 (GRCm39) missense probably damaging 1.00
R2161:Adamts12 UTSW 15 11,215,821 (GRCm39) missense probably damaging 0.99
R2655:Adamts12 UTSW 15 11,065,174 (GRCm39) missense possibly damaging 0.50
R4010:Adamts12 UTSW 15 11,286,169 (GRCm39) missense possibly damaging 0.69
R4666:Adamts12 UTSW 15 11,311,578 (GRCm39) missense probably benign 0.08
R4731:Adamts12 UTSW 15 11,270,748 (GRCm39) missense probably damaging 1.00
R4732:Adamts12 UTSW 15 11,270,748 (GRCm39) missense probably damaging 1.00
R4733:Adamts12 UTSW 15 11,270,748 (GRCm39) missense probably damaging 1.00
R4766:Adamts12 UTSW 15 11,285,987 (GRCm39) missense probably benign 0.03
R4877:Adamts12 UTSW 15 11,327,787 (GRCm39) missense probably damaging 1.00
R4929:Adamts12 UTSW 15 11,259,108 (GRCm39) missense probably damaging 0.96
R5060:Adamts12 UTSW 15 11,300,054 (GRCm39) missense probably damaging 1.00
R5145:Adamts12 UTSW 15 11,285,962 (GRCm39) missense probably damaging 1.00
R5191:Adamts12 UTSW 15 11,327,843 (GRCm39) missense probably benign 0.18
R5492:Adamts12 UTSW 15 11,336,384 (GRCm39) missense probably benign 0.05
R5580:Adamts12 UTSW 15 11,152,086 (GRCm39) missense probably benign 0.14
R5645:Adamts12 UTSW 15 11,277,506 (GRCm39) missense possibly damaging 0.92
R5724:Adamts12 UTSW 15 11,286,836 (GRCm39) missense probably benign 0.15
R6240:Adamts12 UTSW 15 11,286,044 (GRCm39) missense probably benign 0.44
R6331:Adamts12 UTSW 15 11,241,519 (GRCm39) missense probably damaging 1.00
R6381:Adamts12 UTSW 15 11,257,080 (GRCm39) missense possibly damaging 0.93
R6393:Adamts12 UTSW 15 11,255,721 (GRCm39) missense probably damaging 0.97
R6419:Adamts12 UTSW 15 11,215,759 (GRCm39) missense possibly damaging 0.72
R6571:Adamts12 UTSW 15 11,065,187 (GRCm39) missense probably benign 0.00
R6821:Adamts12 UTSW 15 11,152,134 (GRCm39) missense probably benign 0.14
R6913:Adamts12 UTSW 15 11,215,778 (GRCm39) missense probably damaging 1.00
R6973:Adamts12 UTSW 15 11,331,866 (GRCm39) nonsense probably null
R7188:Adamts12 UTSW 15 11,336,411 (GRCm39) nonsense probably null
R7290:Adamts12 UTSW 15 11,277,452 (GRCm39) missense probably benign 0.08
R7307:Adamts12 UTSW 15 11,217,899 (GRCm39) missense probably damaging 1.00
R7376:Adamts12 UTSW 15 11,277,425 (GRCm39) missense possibly damaging 0.69
R7419:Adamts12 UTSW 15 11,317,365 (GRCm39) missense probably benign 0.00
R7484:Adamts12 UTSW 15 11,345,734 (GRCm39) missense probably benign 0.25
R7562:Adamts12 UTSW 15 11,270,697 (GRCm39) missense probably benign 0.01
R7653:Adamts12 UTSW 15 11,257,115 (GRCm39) missense probably benign 0.28
R7696:Adamts12 UTSW 15 11,258,224 (GRCm39) missense probably damaging 1.00
R7957:Adamts12 UTSW 15 11,317,298 (GRCm39) missense possibly damaging 0.96
R7980:Adamts12 UTSW 15 11,263,423 (GRCm39) missense probably damaging 1.00
R7992:Adamts12 UTSW 15 11,310,904 (GRCm39) missense probably benign
R8032:Adamts12 UTSW 15 11,259,189 (GRCm39) critical splice donor site probably null
R8109:Adamts12 UTSW 15 11,331,877 (GRCm39) missense probably benign 0.02
R8402:Adamts12 UTSW 15 11,263,376 (GRCm39) missense probably damaging 0.96
R8751:Adamts12 UTSW 15 11,215,813 (GRCm39) missense probably damaging 1.00
R8782:Adamts12 UTSW 15 11,237,678 (GRCm39) missense probably damaging 1.00
R8934:Adamts12 UTSW 15 11,300,015 (GRCm39) missense probably damaging 0.99
R8952:Adamts12 UTSW 15 11,286,065 (GRCm39) missense probably damaging 1.00
R8963:Adamts12 UTSW 15 11,317,443 (GRCm39) critical splice donor site probably null
R9042:Adamts12 UTSW 15 11,152,134 (GRCm39) missense probably benign 0.08
R9162:Adamts12 UTSW 15 11,311,721 (GRCm39) missense probably benign 0.29
R9190:Adamts12 UTSW 15 11,336,446 (GRCm39) missense probably benign 0.02
R9700:Adamts12 UTSW 15 11,311,442 (GRCm39) missense probably benign 0.04
R9748:Adamts12 UTSW 15 11,310,628 (GRCm39) missense probably damaging 0.99
V1662:Adamts12 UTSW 15 11,071,894 (GRCm39) missense probably benign 0.13
X0022:Adamts12 UTSW 15 11,277,534 (GRCm39) missense probably benign 0.30
Z1176:Adamts12 UTSW 15 11,336,469 (GRCm39) missense not run
Z1177:Adamts12 UTSW 15 11,336,469 (GRCm39) missense not run
Z1177:Adamts12 UTSW 15 11,317,410 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCCATGTTCTGTCCTATG -3'
(R):5'- TAGCATATGTCCAGTCCCCTG -3'

Sequencing Primer
(F):5'- ATGGCCTGCATCACCCTG -3'
(R):5'- AACCTGTTACTATTGGGTTTACAGG -3'
Posted On 2015-06-10