Incidental Mutation 'R4208:C3'
ID 319047
Institutional Source Beutler Lab
Gene Symbol C3
Ensembl Gene ENSMUSG00000024164
Gene Name complement component 3
Synonyms complement factor 3, acylation stimulating protein, Plp
MMRRC Submission 041037-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4208 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 57203970-57228136 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 57205303 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 1542 (D1542N)
Ref Sequence ENSEMBL: ENSMUSP00000024988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024988] [ENSMUST00000177425]
AlphaFold P01027
Predicted Effect possibly damaging
Transcript: ENSMUST00000024988
AA Change: D1542N

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000024988
Gene: ENSMUSG00000024164
AA Change: D1542N

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
Pfam:A2M_N 130 225 3.8e-17 PFAM
A2M_N_2 456 604 5.22e-38 SMART
ANATO 693 728 5.69e-15 SMART
low complexity region 752 762 N/A INTRINSIC
A2M 770 866 5.47e-32 SMART
Pfam:Thiol-ester_cl 1000 1028 4.6e-15 PFAM
Pfam:A2M_comp 1051 1284 7.3e-60 PFAM
A2M_recep 1398 1493 3.98e-43 SMART
C345C 1533 1645 1.85e-48 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177046
Predicted Effect probably benign
Transcript: ENSMUST00000177425
SMART Domains Protein: ENSMUSP00000135663
Gene: ENSMUSG00000024164

DomainStartEndE-ValueType
Pfam:A2M_N_2 1 55 1.6e-10 PFAM
PDB:3L5N|B 74 102 1e-9 PDB
Meta Mutation Damage Score 0.1622 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: This gene encodes complement protein C3 which plays a central role in the classical, alternative and lectin activation pathways of the complement system. The encoded preproprotein undergoes a multi-step processing to generate various functional peptides. Mice deficient in the encoded protein fail to clear bacteria from the blood stream upon infection, display diminished airway hyperresponsiveness and lung eosinophilia upon allergen-induced pulmonary allergy, and develop severe lung injury after deposition of IgG immune complexes. Deficiency of the homolog of the encoded protein in humans was found to be associated with increased susceptibility to infections, age-related macular degeneration, and atypical hemolytic uremic syndrome. [provided by RefSeq, Mar 2015]
PHENOTYPE: Homozygous mutant mice exhibit abnormal immune responses, including increased mortality upon bacterial infection and decreased inflammatory response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A T 6: 48,931,647 D527V probably damaging Het
A1cf T C 19: 31,932,660 L284P probably benign Het
Abca8b G A 11: 109,981,725 Q17* probably null Het
Abcc6 A C 7: 45,986,563 L1020R probably damaging Het
Ace2 A G X: 164,169,585 I110V probably benign Het
Adamts12 A G 15: 11,071,754 H128R probably benign Het
Apol9a G C 15: 77,404,396 T257S probably benign Het
B4galnt3 A G 6: 120,215,102 S557P probably damaging Het
Casp12 T C 9: 5,346,629 L52P probably damaging Het
Cep126 C T 9: 8,100,821 E571K probably damaging Het
Cfhr1 A G 1: 139,547,878 probably benign Het
Cmah A G 13: 24,417,427 probably null Het
Col10a1 C T 10: 34,395,543 P504S probably damaging Het
Ctnna3 T A 10: 64,959,778 D758E probably benign Het
Cyp2c65 T C 19: 39,090,655 S393P probably damaging Het
Dclk2 A G 3: 86,830,822 probably null Het
Dis3 T G 14: 99,095,316 I227L probably benign Het
Efhc2 T C X: 17,230,550 N186S possibly damaging Het
F13b G T 1: 139,516,341 W471L probably damaging Het
Fam181a A G 12: 103,315,914 D26G probably damaging Het
Gabpb2 A G 3: 95,203,934 probably benign Het
Gm7293 A G 9: 51,623,579 noncoding transcript Het
H3f3a C T 1: 180,803,138 R117H probably benign Het
Ino80b G C 6: 83,122,333 P178R probably damaging Het
Kif3b G A 2: 153,323,557 R628Q probably damaging Het
Lars T C 18: 42,229,703 E557G probably benign Het
Ldlrad3 C T 2: 101,953,162 D240N probably damaging Het
Lingo2 T C 4: 35,709,810 I57V probably benign Het
Lsr A G 7: 30,973,094 I27T probably benign Het
Me2 T C 18: 73,791,085 K352R probably benign Het
Met T C 6: 17,548,729 V924A possibly damaging Het
Mpp3 T C 11: 102,000,600 T571A probably benign Het
Olfr1231 A T 2: 89,302,926 I222N probably damaging Het
Olfr665 A G 7: 104,881,603 T299A probably damaging Het
Padi1 C A 4: 140,817,227 V552L possibly damaging Het
Pfkfb1 A T X: 150,622,188 D208V possibly damaging Het
Rnase4 A G 14: 51,105,005 K62R probably benign Het
RP24-126A19.1 C A 5: 146,895,796 R123L noncoding transcript Het
Scn10a T A 9: 119,616,776 E1438V probably damaging Het
Sfmbt2 T A 2: 10,542,982 D458E probably damaging Het
Slitrk3 T A 3: 73,051,157 Y94F possibly damaging Het
Sstr2 A C 11: 113,624,656 T134P probably damaging Het
Steap4 A G 5: 7,980,404 Y420C probably damaging Het
Tamm41 AGGG AGG 6: 115,012,359 probably benign Het
Trav7-3 A G 14: 53,443,746 T82A probably benign Het
Trbv23 A T 6: 41,216,088 I6F probably benign Het
Vmn1r87 A G 7: 13,132,258 V34A probably benign Het
Zc3h7a C T 16: 11,164,644 E6K possibly damaging Het
Zfp606 G A 7: 12,494,175 C683Y probably damaging Het
Other mutations in C3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:C3 APN 17 57226004 missense probably benign 0.01
IGL00741:C3 APN 17 57220206 intron probably benign
IGL01093:C3 APN 17 57223949 missense probably damaging 1.00
IGL01309:C3 APN 17 57209652 intron probably benign
IGL01312:C3 APN 17 57225993 unclassified probably benign
IGL01344:C3 APN 17 57224880 missense probably benign
IGL01514:C3 APN 17 57215866 missense probably benign 0.04
IGL01913:C3 APN 17 57213767 missense probably null 0.01
IGL02165:C3 APN 17 57225092 missense probably benign 0.17
IGL02176:C3 APN 17 57226337 unclassified probably benign
IGL02189:C3 APN 17 57220113 missense probably benign 0.01
IGL02378:C3 APN 17 57212698 missense probably benign 0.19
IGL02422:C3 APN 17 57226823 missense probably damaging 0.98
IGL02715:C3 APN 17 57204158 intron probably benign
IGL02737:C3 APN 17 57204281 missense probably benign 0.08
IGL03201:C3 APN 17 57222249 missense probably damaging 1.00
IGL03210:C3 APN 17 57215846 nonsense probably null
IGL03345:C3 APN 17 57219585 missense probably damaging 1.00
PIT4431001:C3 UTSW 17 57206242 missense probably benign 0.00
PIT4494001:C3 UTSW 17 57209263 missense probably benign 0.01
R0158:C3 UTSW 17 57224851 critical splice donor site probably null
R0318:C3 UTSW 17 57224709 missense probably damaging 0.99
R1132:C3 UTSW 17 57207531 critical splice donor site probably null
R1765:C3 UTSW 17 57224401 splice site probably null
R1793:C3 UTSW 17 57219592 missense possibly damaging 0.93
R1852:C3 UTSW 17 57222823 missense probably damaging 0.98
R1908:C3 UTSW 17 57209489 missense probably damaging 1.00
R1919:C3 UTSW 17 57220135 missense probably damaging 1.00
R1935:C3 UTSW 17 57218829 missense probably damaging 1.00
R2026:C3 UTSW 17 57218562 missense probably damaging 1.00
R2108:C3 UTSW 17 57223974 splice site probably null
R2197:C3 UTSW 17 57219623 missense probably benign 0.32
R2394:C3 UTSW 17 57222303 nonsense probably null
R2998:C3 UTSW 17 57210284 missense probably benign 0.00
R3727:C3 UTSW 17 57207379 missense possibly damaging 0.50
R3767:C3 UTSW 17 57205303 missense possibly damaging 0.96
R3768:C3 UTSW 17 57205303 missense possibly damaging 0.96
R3769:C3 UTSW 17 57205303 missense possibly damaging 0.96
R3770:C3 UTSW 17 57205303 missense possibly damaging 0.96
R3784:C3 UTSW 17 57226067 missense probably damaging 0.99
R3883:C3 UTSW 17 57217173 critical splice acceptor site probably null
R3884:C3 UTSW 17 57217173 critical splice acceptor site probably null
R3950:C3 UTSW 17 57225286 missense probably benign 0.02
R3966:C3 UTSW 17 57218664 missense probably damaging 0.99
R4077:C3 UTSW 17 57205303 missense possibly damaging 0.96
R4078:C3 UTSW 17 57205303 missense possibly damaging 0.96
R4079:C3 UTSW 17 57205303 missense possibly damaging 0.96
R4168:C3 UTSW 17 57218608 missense probably benign 0.00
R4695:C3 UTSW 17 57221057 missense probably benign
R4909:C3 UTSW 17 57226830 critical splice donor site probably null
R5011:C3 UTSW 17 57223236 missense probably benign 0.06
R5094:C3 UTSW 17 57225033 critical splice donor site probably null
R5141:C3 UTSW 17 57219570 missense probably damaging 0.98
R5170:C3 UTSW 17 57223938 missense probably damaging 0.96
R5339:C3 UTSW 17 57224308 missense probably damaging 0.99
R5369:C3 UTSW 17 57221159 missense probably benign 0.45
R5412:C3 UTSW 17 57220187 missense probably benign 0.01
R5439:C3 UTSW 17 57204502 missense probably benign 0.28
R5463:C3 UTSW 17 57211720 missense probably benign 0.08
R5546:C3 UTSW 17 57222976 missense probably damaging 0.99
R5572:C3 UTSW 17 57224673 missense probably damaging 0.99
R5851:C3 UTSW 17 57211612 missense probably null 0.14
R5863:C3 UTSW 17 57223141 missense probably benign 0.06
R5888:C3 UTSW 17 57214831 missense probably damaging 1.00
R5940:C3 UTSW 17 57210244 missense possibly damaging 0.64
R6073:C3 UTSW 17 57206223 missense probably null
R6091:C3 UTSW 17 57221967 nonsense probably null
R6286:C3 UTSW 17 57224118 missense probably damaging 1.00
R6524:C3 UTSW 17 57217264 critical splice donor site probably null
R6868:C3 UTSW 17 57204029 missense possibly damaging 0.55
R6896:C3 UTSW 17 57220864 splice site probably null
R7007:C3 UTSW 17 57218809 missense probably benign 0.00
R7022:C3 UTSW 17 57217286 missense probably damaging 1.00
R7099:C3 UTSW 17 57206276 missense probably benign 0.28
R7117:C3 UTSW 17 57212655 missense probably benign 0.01
R7347:C3 UTSW 17 57223215 missense probably benign 0.09
R7366:C3 UTSW 17 57221162 missense probably benign 0.00
R7423:C3 UTSW 17 57214767 missense probably damaging 1.00
R7425:C3 UTSW 17 57204039 missense possibly damaging 0.81
R7481:C3 UTSW 17 57220136 missense probably damaging 1.00
R7540:C3 UTSW 17 57206220 missense probably benign 0.01
R7746:C3 UTSW 17 57218859 missense probably damaging 1.00
R7771:C3 UTSW 17 57215797 missense probably damaging 1.00
R7884:C3 UTSW 17 57226264 missense probably benign 0.05
R8144:C3 UTSW 17 57226276 missense probably damaging 0.98
R8279:C3 UTSW 17 57215809 missense probably benign 0.28
R8284:C3 UTSW 17 57223938 missense probably benign 0.39
R8328:C3 UTSW 17 57220973 missense probably benign 0.00
R8353:C3 UTSW 17 57212643 missense probably benign 0.00
R8396:C3 UTSW 17 57221029 missense probably benign
R8429:C3 UTSW 17 57222811 missense probably damaging 1.00
R8453:C3 UTSW 17 57212643 missense probably benign 0.00
R8557:C3 UTSW 17 57224383 missense probably benign 0.00
R8738:C3 UTSW 17 57204015 makesense probably null
R8794:C3 UTSW 17 57221011 missense probably benign
R9130:C3 UTSW 17 57211678 missense probably damaging 1.00
R9296:C3 UTSW 17 57204291 missense probably benign
R9432:C3 UTSW 17 57223950 missense probably damaging 1.00
R9451:C3 UTSW 17 57224169 missense probably benign 0.03
R9542:C3 UTSW 17 57225037 missense probably damaging 1.00
R9615:C3 UTSW 17 57211669 missense probably damaging 1.00
R9624:C3 UTSW 17 57220189 missense probably benign 0.00
Z1177:C3 UTSW 17 57217144 missense probably benign 0.07
Z1177:C3 UTSW 17 57226171 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTGCCCTAACTGGTGTGAG -3'
(R):5'- ATGGAGTAGGATAGGTGTTCCC -3'

Sequencing Primer
(F):5'- CTGGTGTGAGTATCTGCCAAAAC -3'
(R):5'- GATAGGTGTTCCCTCTAGAACCAG -3'
Posted On 2015-06-10