Incidental Mutation 'R4208:Cyp2c65'
ID 319050
Institutional Source Beutler Lab
Gene Symbol Cyp2c65
Ensembl Gene ENSMUSG00000067231
Gene Name cytochrome P450, family 2, subfamily c, polypeptide 65
Synonyms
MMRRC Submission 041037-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock # R4208 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 39061015-39093944 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 39090655 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 393 (S393P)
Ref Sequence ENSEMBL: ENSMUSP00000084489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087236]
AlphaFold Q148B1
Predicted Effect probably damaging
Transcript: ENSMUST00000087236
AA Change: S393P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000084489
Gene: ENSMUSG00000067231
AA Change: S393P

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 487 2.1e-160 PFAM
Meta Mutation Damage Score 0.8004 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A T 6: 48,931,647 D527V probably damaging Het
A1cf T C 19: 31,932,660 L284P probably benign Het
Abca8b G A 11: 109,981,725 Q17* probably null Het
Abcc6 A C 7: 45,986,563 L1020R probably damaging Het
Ace2 A G X: 164,169,585 I110V probably benign Het
Adamts12 A G 15: 11,071,754 H128R probably benign Het
Apol9a G C 15: 77,404,396 T257S probably benign Het
B4galnt3 A G 6: 120,215,102 S557P probably damaging Het
C3 C T 17: 57,205,303 D1542N possibly damaging Het
Casp12 T C 9: 5,346,629 L52P probably damaging Het
Cep126 C T 9: 8,100,821 E571K probably damaging Het
Cfhr1 A G 1: 139,547,878 probably benign Het
Cmah A G 13: 24,417,427 probably null Het
Col10a1 C T 10: 34,395,543 P504S probably damaging Het
Ctnna3 T A 10: 64,959,778 D758E probably benign Het
Dclk2 A G 3: 86,830,822 probably null Het
Dis3 T G 14: 99,095,316 I227L probably benign Het
Efhc2 T C X: 17,230,550 N186S possibly damaging Het
F13b G T 1: 139,516,341 W471L probably damaging Het
Fam181a A G 12: 103,315,914 D26G probably damaging Het
Gabpb2 A G 3: 95,203,934 probably benign Het
Gm7293 A G 9: 51,623,579 noncoding transcript Het
H3f3a C T 1: 180,803,138 R117H probably benign Het
Ino80b G C 6: 83,122,333 P178R probably damaging Het
Kif3b G A 2: 153,323,557 R628Q probably damaging Het
Lars T C 18: 42,229,703 E557G probably benign Het
Ldlrad3 C T 2: 101,953,162 D240N probably damaging Het
Lingo2 T C 4: 35,709,810 I57V probably benign Het
Lsr A G 7: 30,973,094 I27T probably benign Het
Me2 T C 18: 73,791,085 K352R probably benign Het
Met T C 6: 17,548,729 V924A possibly damaging Het
Mpp3 T C 11: 102,000,600 T571A probably benign Het
Olfr1231 A T 2: 89,302,926 I222N probably damaging Het
Olfr665 A G 7: 104,881,603 T299A probably damaging Het
Padi1 C A 4: 140,817,227 V552L possibly damaging Het
Pfkfb1 A T X: 150,622,188 D208V possibly damaging Het
Rnase4 A G 14: 51,105,005 K62R probably benign Het
RP24-126A19.1 C A 5: 146,895,796 R123L noncoding transcript Het
Scn10a T A 9: 119,616,776 E1438V probably damaging Het
Sfmbt2 T A 2: 10,542,982 D458E probably damaging Het
Slitrk3 T A 3: 73,051,157 Y94F possibly damaging Het
Sstr2 A C 11: 113,624,656 T134P probably damaging Het
Steap4 A G 5: 7,980,404 Y420C probably damaging Het
Tamm41 AGGG AGG 6: 115,012,359 probably benign Het
Trav7-3 A G 14: 53,443,746 T82A probably benign Het
Trbv23 A T 6: 41,216,088 I6F probably benign Het
Vmn1r87 A G 7: 13,132,258 V34A probably benign Het
Zc3h7a C T 16: 11,164,644 E6K possibly damaging Het
Zfp606 G A 7: 12,494,175 C683Y probably damaging Het
Other mutations in Cyp2c65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Cyp2c65 APN 19 39072177 critical splice acceptor site probably null
IGL01124:Cyp2c65 APN 19 39093510 utr 3 prime probably benign
IGL01895:Cyp2c65 APN 19 39072232 missense possibly damaging 0.90
IGL02544:Cyp2c65 APN 19 39090638 missense probably damaging 1.00
R0172:Cyp2c65 UTSW 19 39087656 missense possibly damaging 0.86
R0378:Cyp2c65 UTSW 19 39073218 missense probably benign 0.19
R0517:Cyp2c65 UTSW 19 39082348 splice site probably benign
R0585:Cyp2c65 UTSW 19 39069242 missense probably benign 0.00
R1770:Cyp2c65 UTSW 19 39082198 missense probably benign 0.07
R2051:Cyp2c65 UTSW 19 39082231 missense probably benign 0.12
R2310:Cyp2c65 UTSW 19 39093382 missense probably benign 0.02
R2911:Cyp2c65 UTSW 19 39087682 missense probably damaging 0.96
R4258:Cyp2c65 UTSW 19 39093428 missense probably benign 0.41
R4734:Cyp2c65 UTSW 19 39072334 missense probably benign 0.00
R4821:Cyp2c65 UTSW 19 39072191 missense probably damaging 1.00
R4926:Cyp2c65 UTSW 19 39061153 missense probably benign 0.00
R5060:Cyp2c65 UTSW 19 39061070 missense unknown
R5091:Cyp2c65 UTSW 19 39087565 critical splice acceptor site probably null
R5433:Cyp2c65 UTSW 19 39093484 missense probably benign 0.00
R6051:Cyp2c65 UTSW 19 39061166 missense probably benign 0.29
R6182:Cyp2c65 UTSW 19 39061162 missense probably benign 0.18
R6400:Cyp2c65 UTSW 19 39061114 missense possibly damaging 0.80
R6586:Cyp2c65 UTSW 19 39082218 missense possibly damaging 0.89
R6672:Cyp2c65 UTSW 19 39087674 missense probably damaging 1.00
R6850:Cyp2c65 UTSW 19 39069091 missense probably benign 0.15
R8075:Cyp2c65 UTSW 19 39072238 missense probably benign 0.10
R8756:Cyp2c65 UTSW 19 39061108 nonsense probably null
R9006:Cyp2c65 UTSW 19 39082270 missense probably damaging 1.00
R9031:Cyp2c65 UTSW 19 39073219 nonsense probably null
R9231:Cyp2c65 UTSW 19 39072217 missense possibly damaging 0.92
R9663:Cyp2c65 UTSW 19 39090626 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ATTACTGCCAGTGGACTACTTC -3'
(R):5'- TAAGCCTCAGGGAGTATTGTGAAAG -3'

Sequencing Primer
(F):5'- AACCCATCCCTTTGTGTTTCATGAC -3'
(R):5'- GAGGGGTTGGAAATATTGTAAGATTC -3'
Posted On 2015-06-10