Incidental Mutation 'R4209:Fezf1'
ID 319063
Institutional Source Beutler Lab
Gene Symbol Fezf1
Ensembl Gene ENSMUSG00000029697
Gene Name Fez family zinc finger 1
Synonyms Zfp312-like, 3110069A13Rik, Fez
MMRRC Submission 041038-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4209 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 23245044-23248362 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 23246617 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 323 (K323E)
Ref Sequence ENSEMBL: ENSMUSP00000031709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031709]
AlphaFold Q0VDQ9
Predicted Effect probably damaging
Transcript: ENSMUST00000031709
AA Change: K323E

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031709
Gene: ENSMUSG00000029697
AA Change: K323E

DomainStartEndE-ValueType
low complexity region 102 114 N/A INTRINSIC
ZnF_C2H2 260 282 1.58e-3 SMART
ZnF_C2H2 288 310 3.39e-3 SMART
ZnF_C2H2 316 338 1.38e-3 SMART
ZnF_C2H2 344 366 2.57e-3 SMART
ZnF_C2H2 372 394 2.53e-2 SMART
ZnF_C2H2 400 423 1.38e-3 SMART
low complexity region 441 467 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202489
Meta Mutation Damage Score 0.4753 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional repressor that belongs to the zinc finger double domain protein family. The encoded protein is thought to play a role in the embryonic migration of gonadotropin-releasing hormone neurons into the brain. Mutations in this gene are associated with hypogonadotropic hypogonadism-22 with anosmia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a null mutation of this gene display neonatal lethality, impaired olfactory bulb development and impaired olfactory bulb interneuron migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak G A 19: 9,002,600 G416D probably damaging Het
Ap3b2 C A 7: 81,477,136 A289S probably benign Het
Arhgap23 C A 11: 97,454,496 T657K probably damaging Het
Bcl9 A G 3: 97,209,953 L475P probably damaging Het
Bean1 T A 8: 104,213,934 M1K probably null Het
Cand1 T A 10: 119,211,558 I676F probably benign Het
Casp3 G T 8: 46,635,388 D107Y probably damaging Het
Cops4 T A 5: 100,547,486 probably benign Het
Dchs1 A T 7: 105,766,190 D626E probably damaging Het
Dpysl2 T C 14: 66,815,477 S308G probably damaging Het
Gm10272 T C 10: 77,706,831 V69A possibly damaging Het
Gm8298 A T 3: 59,877,156 Y350F probably damaging Het
Gtf2f1 A G 17: 57,011,003 V11A probably benign Het
Hnf4a T C 2: 163,568,889 S378P probably benign Het
Inpp5j T G 11: 3,501,107 H514P probably damaging Het
Irf8 T A 8: 120,753,469 Y149N probably damaging Het
Kel C T 6: 41,698,425 W297* probably null Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mcpt8 G A 14: 56,083,918 H30Y probably damaging Het
Mycl G T 4: 122,999,922 V172L possibly damaging Het
Pcgf5 C A 19: 36,437,340 N26K possibly damaging Het
Ppp2r2a A G 14: 67,028,879 L111S probably damaging Het
Prdm2 T C 4: 143,134,437 D761G probably damaging Het
Sec11a A T 7: 80,935,042 I49N probably damaging Het
Sesn3 T C 9: 14,306,209 I30T probably benign Het
Slc22a21 A G 11: 53,956,055 S331P probably benign Het
Slc38a3 T G 9: 107,655,348 S358R possibly damaging Het
Slc9a5 A G 8: 105,358,471 N535D possibly damaging Het
Spns2 T C 11: 72,454,186 D492G probably benign Het
Tcn2 T C 11: 3,922,114 K338E possibly damaging Het
Tdp1 C A 12: 99,898,329 A243E probably damaging Het
Tex16 T A X: 112,120,943 D1046E probably benign Het
Tmem120a T C 5: 135,735,705 N340S probably benign Het
Tnik A T 3: 28,359,065 probably benign Het
Trim36 A G 18: 46,196,124 L71P probably benign Het
Tube1 A G 10: 39,144,934 probably null Het
Urgcp C A 11: 5,715,878 G820V probably damaging Het
Veph1 A T 3: 66,244,546 L154Q probably damaging Het
Vmn1r113 T C 7: 20,787,610 V109A probably benign Het
Vmn1r152 A T 7: 22,523,579 T205S possibly damaging Het
Wdsub1 G A 2: 59,876,805 P28S probably damaging Het
Ybx2 G T 11: 69,935,941 probably benign Het
Zfyve1 A T 12: 83,575,135 V162E probably damaging Het
Other mutations in Fezf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Fezf1 APN 6 23247843 missense possibly damaging 0.76
IGL02538:Fezf1 APN 6 23246558 missense probably damaging 1.00
IGL02983:Fezf1 APN 6 23247872 missense probably damaging 0.99
IGL03372:Fezf1 APN 6 23246910 missense probably damaging 1.00
R0494:Fezf1 UTSW 6 23246055 missense probably damaging 1.00
R0612:Fezf1 UTSW 6 23247029 missense probably damaging 1.00
R0836:Fezf1 UTSW 6 23246999 missense probably benign 0.01
R1930:Fezf1 UTSW 6 23246907 missense probably damaging 1.00
R1931:Fezf1 UTSW 6 23246907 missense probably damaging 1.00
R2103:Fezf1 UTSW 6 23247332 missense possibly damaging 0.55
R2104:Fezf1 UTSW 6 23247332 missense possibly damaging 0.55
R2233:Fezf1 UTSW 6 23246003 missense probably damaging 1.00
R3404:Fezf1 UTSW 6 23247284 missense probably benign 0.13
R3950:Fezf1 UTSW 6 23247420 nonsense probably null
R4400:Fezf1 UTSW 6 23247710 missense probably benign 0.22
R4614:Fezf1 UTSW 6 23247858 missense possibly damaging 0.71
R5287:Fezf1 UTSW 6 23248011 missense probably benign
R5878:Fezf1 UTSW 6 23247581 missense possibly damaging 0.71
R5943:Fezf1 UTSW 6 23246949 nonsense probably null
R5952:Fezf1 UTSW 6 23247428 missense probably benign 0.08
R6663:Fezf1 UTSW 6 23247528 missense probably damaging 1.00
R7158:Fezf1 UTSW 6 23245790 missense probably benign
R7184:Fezf1 UTSW 6 23247836 missense probably benign 0.31
R8679:Fezf1 UTSW 6 23247770 missense probably benign
R9294:Fezf1 UTSW 6 23245798 missense possibly damaging 0.96
X0025:Fezf1 UTSW 6 23247909 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTCAGGTAAGCAGGTACAC -3'
(R):5'- TCTTTAGCATAAGACCTTCTGGGC -3'

Sequencing Primer
(F):5'- CTCAGGTAAGCAGGTACACTTTAG -3'
(R):5'- ACCTTCTGGGCTGTGGAG -3'
Posted On 2015-06-10