Incidental Mutation 'R4209:Gm10272'
ID319077
Institutional Source Beutler Lab
Gene Symbol Gm10272
Ensembl Gene ENSMUSG00000069584
Gene Namepredicted gene 10272
Synonyms
MMRRC Submission 041038-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R4209 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location77706626-77706975 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 77706831 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 69 (V69A)
Ref Sequence ENSEMBL: ENSMUSP00000090025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075421] [ENSMUST00000092366] [ENSMUST00000092371]
Predicted Effect probably benign
Transcript: ENSMUST00000075421
SMART Domains Protein: ENSMUSP00000074876
Gene: ENSMUSG00000094012

DomainStartEndE-ValueType
Pfam:Keratin_B2_2 1 53 2.6e-8 PFAM
Pfam:Keratin_B2_2 29 74 9.2e-10 PFAM
low complexity region 92 105 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092366
SMART Domains Protein: ENSMUSP00000090020
Gene: ENSMUSG00000069581

DomainStartEndE-ValueType
Blast:TSPN 1 71 8e-40 BLAST
SCOP:d1c4ra_ 2 67 2e-7 SMART
low complexity region 190 200 N/A INTRINSIC
Pfam:EPTP 208 255 2.6e-22 PFAM
Pfam:EPTP 260 307 1.4e-21 PFAM
Pfam:EPTP 312 359 8.9e-14 PFAM
Pfam:EPTP 362 417 6.2e-13 PFAM
Pfam:EPTP 422 469 1.3e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000092371
AA Change: V69A

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000090025
Gene: ENSMUSG00000069584
AA Change: V69A

DomainStartEndE-ValueType
Pfam:Keratin_B2_2 1 53 1.8e-7 PFAM
Pfam:Keratin_B2_2 40 83 3.7e-7 PFAM
Meta Mutation Damage Score 0.3790 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak G A 19: 9,002,600 G416D probably damaging Het
Ap3b2 C A 7: 81,477,136 A289S probably benign Het
Arhgap23 C A 11: 97,454,496 T657K probably damaging Het
Bcl9 A G 3: 97,209,953 L475P probably damaging Het
Bean1 T A 8: 104,213,934 M1K probably null Het
Cand1 T A 10: 119,211,558 I676F probably benign Het
Casp3 G T 8: 46,635,388 D107Y probably damaging Het
Cops4 T A 5: 100,547,486 probably benign Het
Dchs1 A T 7: 105,766,190 D626E probably damaging Het
Dpysl2 T C 14: 66,815,477 S308G probably damaging Het
Fezf1 T C 6: 23,246,617 K323E probably damaging Het
Gm8298 A T 3: 59,877,156 Y350F probably damaging Het
Gtf2f1 A G 17: 57,011,003 V11A probably benign Het
Hnf4a T C 2: 163,568,889 S378P probably benign Het
Inpp5j T G 11: 3,501,107 H514P probably damaging Het
Irf8 T A 8: 120,753,469 Y149N probably damaging Het
Kel C T 6: 41,698,425 W297* probably null Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mcpt8 G A 14: 56,083,918 H30Y probably damaging Het
Mycl G T 4: 122,999,922 V172L possibly damaging Het
Pcgf5 C A 19: 36,437,340 N26K possibly damaging Het
Ppp2r2a A G 14: 67,028,879 L111S probably damaging Het
Prdm2 T C 4: 143,134,437 D761G probably damaging Het
Sec11a A T 7: 80,935,042 I49N probably damaging Het
Sesn3 T C 9: 14,306,209 I30T probably benign Het
Slc22a21 A G 11: 53,956,055 S331P probably benign Het
Slc38a3 T G 9: 107,655,348 S358R possibly damaging Het
Slc9a5 A G 8: 105,358,471 N535D possibly damaging Het
Spns2 T C 11: 72,454,186 D492G probably benign Het
Tcn2 T C 11: 3,922,114 K338E possibly damaging Het
Tdp1 C A 12: 99,898,329 A243E probably damaging Het
Tex16 T A X: 112,120,943 D1046E probably benign Het
Tmem120a T C 5: 135,735,705 N340S probably benign Het
Tnik A T 3: 28,359,065 probably benign Het
Trim36 A G 18: 46,196,124 L71P probably benign Het
Tube1 A G 10: 39,144,934 probably null Het
Urgcp C A 11: 5,715,878 G820V probably damaging Het
Veph1 A T 3: 66,244,546 L154Q probably damaging Het
Vmn1r113 T C 7: 20,787,610 V109A probably benign Het
Vmn1r152 A T 7: 22,523,579 T205S possibly damaging Het
Wdsub1 G A 2: 59,876,805 P28S probably damaging Het
Ybx2 G T 11: 69,935,941 probably benign Het
Zfyve1 A T 12: 83,575,135 V162E probably damaging Het
Other mutations in Gm10272
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01975:Gm10272 APN 10 77706774 missense probably damaging 1.00
IGL03176:Gm10272 APN 10 77706633 missense probably null
R0635:Gm10272 UTSW 10 77706701 intron probably benign
R7540:Gm10272 UTSW 10 77706626 start codon destroyed unknown
R7887:Gm10272 UTSW 10 77706945 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ATCTTGCTGTGTGTCCAGC -3'
(R):5'- CTAGGTGTGCTTCCAGTCTG -3'

Sequencing Primer
(F):5'- TGTGTGTCCAGCCCCTG -3'
(R):5'- CCAGTCTGTTTCAAGTGCAGAAC -3'
Posted On2015-06-10