Incidental Mutation 'R4209:Spns2'
ID319084
Institutional Source Beutler Lab
Gene Symbol Spns2
Ensembl Gene ENSMUSG00000040447
Gene Namespinster homolog 2
Synonyms
MMRRC Submission 041038-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4209 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location72451638-72489904 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72454186 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 492 (D492G)
Ref Sequence ENSEMBL: ENSMUSP00000044418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045303] [ENSMUST00000045633]
Predicted Effect probably benign
Transcript: ENSMUST00000045303
AA Change: D492G

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000044418
Gene: ENSMUSG00000040447
AA Change: D492G

DomainStartEndE-ValueType
low complexity region 5 53 N/A INTRINSIC
Pfam:Sugar_tr 104 308 7.6e-16 PFAM
Pfam:OATP 106 427 7.2e-13 PFAM
Pfam:MFS_1 108 476 2.7e-37 PFAM
transmembrane domain 506 528 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000045633
SMART Domains Protein: ENSMUSP00000044827
Gene: ENSMUSG00000040463

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
Pfam:DNA_pol_phi 70 835 1.2e-194 PFAM
low complexity region 839 852 N/A INTRINSIC
low complexity region 1080 1090 N/A INTRINSIC
low complexity region 1109 1122 N/A INTRINSIC
low complexity region 1259 1269 N/A INTRINSIC
low complexity region 1314 1329 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126452
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144374
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144923
Predicted Effect unknown
Transcript: ENSMUST00000144940
AA Change: D73G
SMART Domains Protein: ENSMUSP00000120722
Gene: ENSMUSG00000040447
AA Change: D73G

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150491
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155995
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162048
Meta Mutation Damage Score 0.1059 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transporter of sphingosine 1-phosphate, a secreted lipid that is important in cardiovascular, immunological, and neural development. Defects in this gene are a cause of early onset progressive hearing loss. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit symblepharon and impaired egress of T and B cells from the thymus and bone marrow, respectively. Mice homozygous for a different knock-out allele exhibit abnormal immune system, abnormal eye morphology and absent pinna reflex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak G A 19: 9,002,600 G416D probably damaging Het
Ap3b2 C A 7: 81,477,136 A289S probably benign Het
Arhgap23 C A 11: 97,454,496 T657K probably damaging Het
Bcl9 A G 3: 97,209,953 L475P probably damaging Het
Bean1 T A 8: 104,213,934 M1K probably null Het
Cand1 T A 10: 119,211,558 I676F probably benign Het
Casp3 G T 8: 46,635,388 D107Y probably damaging Het
Cops4 T A 5: 100,547,486 probably benign Het
Dchs1 A T 7: 105,766,190 D626E probably damaging Het
Dpysl2 T C 14: 66,815,477 S308G probably damaging Het
Fezf1 T C 6: 23,246,617 K323E probably damaging Het
Gm10272 T C 10: 77,706,831 V69A possibly damaging Het
Gm8298 A T 3: 59,877,156 Y350F probably damaging Het
Gtf2f1 A G 17: 57,011,003 V11A probably benign Het
Hnf4a T C 2: 163,568,889 S378P probably benign Het
Inpp5j T G 11: 3,501,107 H514P probably damaging Het
Irf8 T A 8: 120,753,469 Y149N probably damaging Het
Kel C T 6: 41,698,425 W297* probably null Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mcpt8 G A 14: 56,083,918 H30Y probably damaging Het
Mycl G T 4: 122,999,922 V172L possibly damaging Het
Pcgf5 C A 19: 36,437,340 N26K possibly damaging Het
Ppp2r2a A G 14: 67,028,879 L111S probably damaging Het
Prdm2 T C 4: 143,134,437 D761G probably damaging Het
Sec11a A T 7: 80,935,042 I49N probably damaging Het
Sesn3 T C 9: 14,306,209 I30T probably benign Het
Slc22a21 A G 11: 53,956,055 S331P probably benign Het
Slc38a3 T G 9: 107,655,348 S358R possibly damaging Het
Slc9a5 A G 8: 105,358,471 N535D possibly damaging Het
Tcn2 T C 11: 3,922,114 K338E possibly damaging Het
Tdp1 C A 12: 99,898,329 A243E probably damaging Het
Tex16 T A X: 112,120,943 D1046E probably benign Het
Tmem120a T C 5: 135,735,705 N340S probably benign Het
Tnik A T 3: 28,359,065 probably benign Het
Trim36 A G 18: 46,196,124 L71P probably benign Het
Tube1 A G 10: 39,144,934 probably null Het
Urgcp C A 11: 5,715,878 G820V probably damaging Het
Veph1 A T 3: 66,244,546 L154Q probably damaging Het
Vmn1r113 T C 7: 20,787,610 V109A probably benign Het
Vmn1r152 A T 7: 22,523,579 T205S possibly damaging Het
Wdsub1 G A 2: 59,876,805 P28S probably damaging Het
Ybx2 G T 11: 69,935,941 probably benign Het
Zfyve1 A T 12: 83,575,135 V162E probably damaging Het
Other mutations in Spns2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01733:Spns2 APN 11 72456510 missense possibly damaging 0.79
IGL01804:Spns2 APN 11 72457304 missense possibly damaging 0.89
elderly UTSW 11 72456370 critical splice acceptor site probably null
homely UTSW 11 72456860 missense probably damaging 1.00
whistler UTSW 11 72458687 nonsense probably null
Wrinkled UTSW 11 72456878 missense possibly damaging 0.81
R0883:Spns2 UTSW 11 72454397 missense probably damaging 1.00
R1544:Spns2 UTSW 11 72456367 missense probably benign 0.30
R1696:Spns2 UTSW 11 72456347 missense probably benign 0.25
R2046:Spns2 UTSW 11 72459040 missense possibly damaging 0.49
R2164:Spns2 UTSW 11 72458671 missense possibly damaging 0.82
R2259:Spns2 UTSW 11 72457268 missense probably benign 0.35
R5285:Spns2 UTSW 11 72489479 missense possibly damaging 0.92
R6883:Spns2 UTSW 11 72456370 critical splice acceptor site probably null
R6990:Spns2 UTSW 11 72489621 missense probably benign 0.08
R7221:Spns2 UTSW 11 72456916 missense probably benign 0.43
R7227:Spns2 UTSW 11 72458687 nonsense probably null
R7243:Spns2 UTSW 11 72456860 missense probably damaging 1.00
R7390:Spns2 UTSW 11 72456878 missense possibly damaging 0.81
R7699:Spns2 UTSW 11 72489617 nonsense probably null
R7700:Spns2 UTSW 11 72489617 nonsense probably null
R8042:Spns2 UTSW 11 72454177 missense possibly damaging 0.46
R8155:Spns2 UTSW 11 72456568 missense possibly damaging 0.46
R8553:Spns2 UTSW 11 72457227 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGTCCCTGCTTCACAGTG -3'
(R):5'- CATGGATCTTCTAGCCCTGACC -3'

Sequencing Primer
(F):5'- TGCTTCACAGTGCGCCC -3'
(R):5'- TGGTCATCCCCACTCGG -3'
Posted On2015-06-10