Incidental Mutation 'R4210:Olfr430'
ID319102
Institutional Source Beutler Lab
Gene Symbol Olfr430
Ensembl Gene ENSMUSG00000050134
Gene Nameolfactory receptor 430
SynonymsGA_x6K02T2P20D-21108443-21107490, MOR105-5P
MMRRC Submission 041039-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R4210 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location174066605-174072273 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 174070008 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 237 (A237T)
Ref Sequence ENSEMBL: ENSMUSP00000150930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055873] [ENSMUST00000213425] [ENSMUST00000214390]
Predicted Effect probably damaging
Transcript: ENSMUST00000055873
AA Change: A237T

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130615
Gene: ENSMUSG00000050134
AA Change: A237T

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.4e-65 PFAM
Pfam:7tm_1 41 290 9.9e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213425
AA Change: A237T

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000214390
AA Change: A237T

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik C T 2: 68,659,878 probably benign Het
Abl1 T C 2: 31,801,696 Y1076H probably damaging Het
Adamts7 C T 9: 90,194,010 T1265I possibly damaging Het
Adgb T C 10: 10,407,465 I166V probably benign Het
Axin2 T A 11: 108,942,576 I529N possibly damaging Het
Bbof1 T C 12: 84,409,183 M1T probably null Het
BC051142 G T 17: 34,460,283 probably benign Het
Clcc1 A T 3: 108,663,591 Y105F possibly damaging Het
Cmpk2 G T 12: 26,469,571 A74S probably benign Het
Colgalt1 G A 8: 71,622,706 V419I probably benign Het
Crybg3 A G 16: 59,544,051 S2403P probably damaging Het
D930048N14Rik G A 11: 51,654,805 probably benign Het
Dnah7b T A 1: 46,137,418 C733S possibly damaging Het
Drc1 G A 5: 30,347,146 V211M possibly damaging Het
Ephx2 T C 14: 66,084,944 T525A probably damaging Het
Eya4 A G 10: 23,226,800 probably null Het
Foxc1 T C 13: 31,807,707 F167S probably damaging Het
Fsip2 C T 2: 82,975,149 T604I probably damaging Het
Gm6370 C A 5: 146,493,924 F306L possibly damaging Het
Hmgcr A G 13: 96,660,221 V187A probably damaging Het
Igkv9-129 T A 6: 67,840,258 S114R possibly damaging Het
Ikbke T A 1: 131,263,348 I519F probably damaging Het
Ikzf3 T C 11: 98,490,487 Y89C probably benign Het
Inpp5j T G 11: 3,501,107 H514P probably damaging Het
Iqsec3 T C 6: 121,413,040 probably benign Het
Itga3 C A 11: 95,062,623 V298L probably benign Het
Kel C T 6: 41,698,425 W297* probably null Het
Larp7 T A 3: 127,546,954 R112S probably benign Het
Lbh T A 17: 72,921,183 probably null Het
Lrba G A 3: 86,360,126 G1708S probably damaging Het
Lrig2 C T 3: 104,467,304 V154I probably benign Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mast4 A T 13: 102,739,205 F1318L probably damaging Het
Ncam2 T C 16: 81,527,103 V545A probably benign Het
Numa1 T G 7: 102,009,738 L356R probably damaging Het
Olfr263 A T 13: 21,133,437 I221L possibly damaging Het
Pcgf5 C A 19: 36,437,340 N26K possibly damaging Het
Pdlim4 T G 11: 54,055,918 D181A possibly damaging Het
Phtf1 G A 3: 104,003,603 probably null Het
Pik3r4 G A 9: 105,650,758 A437T possibly damaging Het
Proser3 G A 7: 30,546,100 probably benign Het
Rax T A 18: 65,935,081 N318Y unknown Het
Rnf152 A G 1: 105,284,352 V160A probably benign Het
Serpina3a A T 12: 104,118,643 D99V probably benign Het
Sidt2 T C 9: 45,942,775 T652A probably benign Het
Slc12a7 A G 13: 73,814,843 Y1054C probably damaging Het
Slc9a5 A G 8: 105,358,471 N535D possibly damaging Het
Sspo C A 6: 48,464,901 H1948Q probably benign Het
Stap2 G T 17: 55,997,827 Y318* probably null Het
Sytl1 T C 4: 133,253,565 D421G probably damaging Het
Taar7e A T 10: 24,038,034 I141F probably damaging Het
Taar7f T A 10: 24,050,023 W172R probably damaging Het
Tcn2 T C 11: 3,922,114 K338E possibly damaging Het
Tenm3 C T 8: 48,349,404 G374D probably damaging Het
Terf2 A G 8: 107,079,448 S291P probably damaging Het
Tex16 T A X: 112,120,943 D1046E probably benign Het
Tmod4 A G 3: 95,127,829 D215G probably benign Het
Tnxb T C 17: 34,710,977 I2895T possibly damaging Het
Urgcp C A 11: 5,715,878 G820V probably damaging Het
Uxs1 T A 1: 43,750,238 H419L possibly damaging Het
Vmn1r152 A T 7: 22,523,579 T205S possibly damaging Het
Vmn1r79 A G 7: 12,176,488 Y99C possibly damaging Het
Zc3h14 A G 12: 98,785,399 H199R probably damaging Het
Zfand2b A T 1: 75,169,810 M110L probably benign Het
Zfp976 A G 7: 42,616,325 F12S probably damaging Het
Other mutations in Olfr430
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Olfr430 APN 1 174070066 missense probably benign 0.00
IGL02279:Olfr430 APN 1 174069391 missense probably null 1.00
IGL02537:Olfr430 APN 1 174069454 missense possibly damaging 0.63
R0323:Olfr430 UTSW 1 174069327 missense probably benign
R0627:Olfr430 UTSW 1 174070077 missense probably damaging 1.00
R1079:Olfr430 UTSW 1 174069466 missense possibly damaging 0.95
R1757:Olfr430 UTSW 1 174069658 missense probably damaging 1.00
R1902:Olfr430 UTSW 1 174070126 missense probably damaging 0.96
R3804:Olfr430 UTSW 1 174069908 missense probably damaging 1.00
R3927:Olfr430 UTSW 1 174069312 missense probably damaging 1.00
R3930:Olfr430 UTSW 1 174069581 missense probably damaging 1.00
R3931:Olfr430 UTSW 1 174069581 missense probably damaging 1.00
R4111:Olfr430 UTSW 1 174069433 missense probably damaging 1.00
R4383:Olfr430 UTSW 1 174069477 missense probably benign 0.34
R4651:Olfr430 UTSW 1 174069828 missense possibly damaging 0.54
R5097:Olfr430 UTSW 1 174069529 missense probably benign 0.22
R5385:Olfr430 UTSW 1 174069470 missense probably benign 0.31
R5722:Olfr430 UTSW 1 174069870 missense probably damaging 1.00
R6608:Olfr430 UTSW 1 174069729 missense probably benign 0.00
R6643:Olfr430 UTSW 1 174070045 missense probably damaging 1.00
R7316:Olfr430 UTSW 1 174070161 missense probably benign 0.00
R7532:Olfr430 UTSW 1 174070098 missense probably benign 0.37
Z1088:Olfr430 UTSW 1 174069949 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGTTATCCTTGTCTCTCAGC -3'
(R):5'- TGGCCTGAATGAGTTCCTTG -3'

Sequencing Primer
(F):5'- AGCTCCCCTTCTGTAACTATAATGAG -3'
(R):5'- CTGAATGAGTTCCTTGTTTCGAAGAC -3'
Posted On2015-06-10