Incidental Mutation 'R4210:Abl1'
ID319103
Institutional Source Beutler Lab
Gene Symbol Abl1
Ensembl Gene ENSMUSG00000026842
Gene Namec-abl oncogene 1, non-receptor tyrosine kinase
Synonymsc-Abl, E430008G22Rik
MMRRC Submission 041039-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.941) question?
Stock #R4210 (G1)
Quality Score221
Status Not validated
Chromosome2
Chromosomal Location31688376-31804227 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31801696 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1076 (Y1076H)
Ref Sequence ENSEMBL: ENSMUSP00000075167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028190] [ENSMUST00000057407] [ENSMUST00000075759] [ENSMUST00000142554]
Predicted Effect probably benign
Transcript: ENSMUST00000028190
AA Change: Y1057H

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000028190
Gene: ENSMUSG00000026842
AA Change: Y1057H

DomainStartEndE-ValueType
low complexity region 5 23 N/A INTRINSIC
SH3 64 120 6.95e-16 SMART
SH2 125 208 6.52e-32 SMART
TyrKc 242 493 4.48e-149 SMART
low complexity region 698 703 N/A INTRINSIC
low complexity region 802 810 N/A INTRINSIC
low complexity region 883 907 N/A INTRINSIC
low complexity region 949 960 N/A INTRINSIC
low complexity region 964 983 N/A INTRINSIC
FABD 997 1123 1.36e-63 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000057407
SMART Domains Protein: ENSMUSP00000055746
Gene: ENSMUSG00000043102

DomainStartEndE-ValueType
Pfam:RFamide_26RFa 4 124 1.4e-55 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000075759
AA Change: Y1076H

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000075167
Gene: ENSMUSG00000026842
AA Change: Y1076H

DomainStartEndE-ValueType
SH3 83 139 6.95e-16 SMART
SH2 144 227 6.52e-32 SMART
TyrKc 261 512 4.48e-149 SMART
low complexity region 717 722 N/A INTRINSIC
low complexity region 821 829 N/A INTRINSIC
low complexity region 902 926 N/A INTRINSIC
low complexity region 968 979 N/A INTRINSIC
low complexity region 983 1002 N/A INTRINSIC
FABD 1016 1142 1.36e-63 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124726
Predicted Effect probably benign
Transcript: ENSMUST00000142554
SMART Domains Protein: ENSMUSP00000142123
Gene: ENSMUSG00000026842

DomainStartEndE-ValueType
PDB:1OPL|B 1 47 2e-27 PDB
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a protooncogene that encodes a protein tyrosine kinase involved in a variety of cellular processes, including cell division, adhesion, differentiation, and response to stress. The activity of the protein is negatively regulated by its SH3 domain, whereby deletion of the region encoding this domain results in an oncogene. The ubiquitously expressed protein has DNA-binding activity that is regulated by CDC2-mediated phosphorylation, suggesting a cell cycle function. This gene has been found fused to a variety of translocation partner genes in various leukemias, most notably the t(9;22) translocation that results in a fusion with the 5' end of the breakpoint cluster region gene (BCR; MIM:151410). Alternative splicing of this gene results in two transcript variants, which contain alternative first exons that are spliced to the remaining common exons. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene have increased perinatal and postnatal mortality and may display foreshortened crania, abnormal development of spleen, head, heart and eye, reduced B and T cell populations, and osteoporosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik C T 2: 68,659,878 probably benign Het
Adamts7 C T 9: 90,194,010 T1265I possibly damaging Het
Adgb T C 10: 10,407,465 I166V probably benign Het
Axin2 T A 11: 108,942,576 I529N possibly damaging Het
Bbof1 T C 12: 84,409,183 M1T probably null Het
BC051142 G T 17: 34,460,283 probably benign Het
Clcc1 A T 3: 108,663,591 Y105F possibly damaging Het
Cmpk2 G T 12: 26,469,571 A74S probably benign Het
Colgalt1 G A 8: 71,622,706 V419I probably benign Het
Crybg3 A G 16: 59,544,051 S2403P probably damaging Het
D930048N14Rik G A 11: 51,654,805 probably benign Het
Dnah7b T A 1: 46,137,418 C733S possibly damaging Het
Drc1 G A 5: 30,347,146 V211M possibly damaging Het
Ephx2 T C 14: 66,084,944 T525A probably damaging Het
Eya4 A G 10: 23,226,800 probably null Het
Foxc1 T C 13: 31,807,707 F167S probably damaging Het
Fsip2 C T 2: 82,975,149 T604I probably damaging Het
Gm6370 C A 5: 146,493,924 F306L possibly damaging Het
Hmgcr A G 13: 96,660,221 V187A probably damaging Het
Igkv9-129 T A 6: 67,840,258 S114R possibly damaging Het
Ikbke T A 1: 131,263,348 I519F probably damaging Het
Ikzf3 T C 11: 98,490,487 Y89C probably benign Het
Inpp5j T G 11: 3,501,107 H514P probably damaging Het
Iqsec3 T C 6: 121,413,040 probably benign Het
Itga3 C A 11: 95,062,623 V298L probably benign Het
Kel C T 6: 41,698,425 W297* probably null Het
Larp7 T A 3: 127,546,954 R112S probably benign Het
Lbh T A 17: 72,921,183 probably null Het
Lrba G A 3: 86,360,126 G1708S probably damaging Het
Lrig2 C T 3: 104,467,304 V154I probably benign Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mast4 A T 13: 102,739,205 F1318L probably damaging Het
Ncam2 T C 16: 81,527,103 V545A probably benign Het
Numa1 T G 7: 102,009,738 L356R probably damaging Het
Olfr263 A T 13: 21,133,437 I221L possibly damaging Het
Olfr430 G A 1: 174,070,008 A237T probably damaging Het
Pcgf5 C A 19: 36,437,340 N26K possibly damaging Het
Pdlim4 T G 11: 54,055,918 D181A possibly damaging Het
Phtf1 G A 3: 104,003,603 probably null Het
Pik3r4 G A 9: 105,650,758 A437T possibly damaging Het
Proser3 G A 7: 30,546,100 probably benign Het
Rax T A 18: 65,935,081 N318Y unknown Het
Rnf152 A G 1: 105,284,352 V160A probably benign Het
Serpina3a A T 12: 104,118,643 D99V probably benign Het
Sidt2 T C 9: 45,942,775 T652A probably benign Het
Slc12a7 A G 13: 73,814,843 Y1054C probably damaging Het
Slc9a5 A G 8: 105,358,471 N535D possibly damaging Het
Sspo C A 6: 48,464,901 H1948Q probably benign Het
Stap2 G T 17: 55,997,827 Y318* probably null Het
Sytl1 T C 4: 133,253,565 D421G probably damaging Het
Taar7e A T 10: 24,038,034 I141F probably damaging Het
Taar7f T A 10: 24,050,023 W172R probably damaging Het
Tcn2 T C 11: 3,922,114 K338E possibly damaging Het
Tenm3 C T 8: 48,349,404 G374D probably damaging Het
Terf2 A G 8: 107,079,448 S291P probably damaging Het
Tex16 T A X: 112,120,943 D1046E probably benign Het
Tmod4 A G 3: 95,127,829 D215G probably benign Het
Tnxb T C 17: 34,710,977 I2895T possibly damaging Het
Urgcp C A 11: 5,715,878 G820V probably damaging Het
Uxs1 T A 1: 43,750,238 H419L possibly damaging Het
Vmn1r152 A T 7: 22,523,579 T205S possibly damaging Het
Vmn1r79 A G 7: 12,176,488 Y99C possibly damaging Het
Zc3h14 A G 12: 98,785,399 H199R probably damaging Het
Zfand2b A T 1: 75,169,810 M110L probably benign Het
Zfp976 A G 7: 42,616,325 F12S probably damaging Het
Other mutations in Abl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Abl1 APN 2 31790812 missense probably damaging 1.00
IGL01453:Abl1 APN 2 31778977 missense probably damaging 0.99
IGL02079:Abl1 APN 2 31689948 splice site probably benign
IGL02179:Abl1 APN 2 31792249 missense probably damaging 1.00
IGL02424:Abl1 APN 2 31801132 missense probably benign
IGL02824:Abl1 APN 2 31800819 missense probably damaging 1.00
Hourglass UTSW 2 31794574 missense probably damaging 1.00
Sands UTSW 2 31779010 missense probably damaging 1.00
R0733:Abl1 UTSW 2 31778945 missense probably damaging 1.00
R1222:Abl1 UTSW 2 31800994 missense probably benign
R1428:Abl1 UTSW 2 31801810 missense probably damaging 0.99
R1582:Abl1 UTSW 2 31800359 missense probably damaging 1.00
R1596:Abl1 UTSW 2 31790338 missense probably damaging 0.99
R1824:Abl1 UTSW 2 31800644 missense probably benign 0.01
R2240:Abl1 UTSW 2 31800505 missense probably benign 0.17
R2251:Abl1 UTSW 2 31779119 missense probably damaging 1.00
R2405:Abl1 UTSW 2 31800974 missense possibly damaging 0.50
R2893:Abl1 UTSW 2 31797612 missense probably benign 0.22
R3952:Abl1 UTSW 2 31784537 missense probably damaging 1.00
R4119:Abl1 UTSW 2 31801727 missense probably damaging 1.00
R4809:Abl1 UTSW 2 31800242 missense probably damaging 1.00
R4854:Abl1 UTSW 2 31779010 missense probably damaging 1.00
R5345:Abl1 UTSW 2 31797047 missense probably damaging 0.97
R5518:Abl1 UTSW 2 31790742 missense probably damaging 1.00
R5551:Abl1 UTSW 2 31801670 missense probably benign 0.03
R5568:Abl1 UTSW 2 31779074 missense probably damaging 1.00
R5627:Abl1 UTSW 2 31800583 missense probably benign 0.00
R6435:Abl1 UTSW 2 31801549 missense possibly damaging 0.93
R6492:Abl1 UTSW 2 31801655 missense probably benign 0.38
R6738:Abl1 UTSW 2 31794574 missense probably damaging 1.00
R7310:Abl1 UTSW 2 31800592 missense possibly damaging 0.93
R7398:Abl1 UTSW 2 31790799 missense probably damaging 1.00
R7639:Abl1 UTSW 2 31779161 missense probably damaging 1.00
R7674:Abl1 UTSW 2 31689829 missense possibly damaging 0.91
R7781:Abl1 UTSW 2 31790697 missense probably damaging 1.00
R7802:Abl1 UTSW 2 31760426 missense probably benign
Z1176:Abl1 UTSW 2 31689827 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTCATATCAACCCGTGTG -3'
(R):5'- ACATACACTGGTTGCTGCTAC -3'

Sequencing Primer
(F):5'- AACCCGTGTGTCTCTTAGGAAGAC -3'
(R):5'- GATCTCCTTCACAGAGCTGAG -3'
Posted On2015-06-10