Incidental Mutation 'R4210:Numa1'
ID319128
Institutional Source Beutler Lab
Gene Symbol Numa1
Ensembl Gene ENSMUSG00000066306
Gene Namenuclear mitotic apparatus protein 1
Synonyms6720401E04Rik
MMRRC Submission 041039-MU
Accession Numbers

Genbank: NM_133947.3; Ensembl: ENSMUST00000084852

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4210 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location101934111-102014964 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 102009738 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 356 (L356R)
Ref Sequence ENSEMBL: ENSMUSP00000126180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084852] [ENSMUST00000163183]
Predicted Effect probably damaging
Transcript: ENSMUST00000084852
AA Change: L1709R

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000081912
Gene: ENSMUSG00000066306
AA Change: L1709R

DomainStartEndE-ValueType
low complexity region 187 201 N/A INTRINSIC
coiled coil region 211 249 N/A INTRINSIC
coiled coil region 274 818 N/A INTRINSIC
low complexity region 856 869 N/A INTRINSIC
internal_repeat_1 910 933 6.03e-6 PROSPERO
internal_repeat_2 911 951 2.35e-5 PROSPERO
low complexity region 979 992 N/A INTRINSIC
low complexity region 1002 1018 N/A INTRINSIC
low complexity region 1063 1081 N/A INTRINSIC
internal_repeat_5 1094 1116 4.63e-5 PROSPERO
low complexity region 1130 1138 N/A INTRINSIC
low complexity region 1220 1233 N/A INTRINSIC
low complexity region 1271 1289 N/A INTRINSIC
low complexity region 1364 1374 N/A INTRINSIC
coiled coil region 1464 1681 N/A INTRINSIC
low complexity region 1700 1711 N/A INTRINSIC
internal_repeat_3 1718 1755 4.63e-5 PROSPERO
internal_repeat_4 1777 1819 4.63e-5 PROSPERO
internal_repeat_3 1800 1842 4.63e-5 PROSPERO
internal_repeat_4 1811 1854 4.63e-5 PROSPERO
low complexity region 1859 1875 N/A INTRINSIC
PDB:3RO2|B 1881 1908 3e-13 PDB
internal_repeat_2 1938 1977 2.35e-5 PROSPERO
internal_repeat_5 1973 1995 4.63e-5 PROSPERO
internal_repeat_1 2020 2043 6.03e-6 PROSPERO
low complexity region 2073 2085 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163183
AA Change: L356R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126180
Gene: ENSMUSG00000066306
AA Change: L356R

DomainStartEndE-ValueType
coiled coil region 7 73 N/A INTRINSIC
low complexity region 150 160 N/A INTRINSIC
SCOP:d1fxkc_ 164 290 7e-3 SMART
low complexity region 347 358 N/A INTRINSIC
low complexity region 506 522 N/A INTRINSIC
PDB:3RO2|B 528 555 2e-10 PDB
low complexity region 720 732 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209583
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210353
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that forms a structural component of the nuclear matrix. The encoded protein interacts with microtubules and plays a role in the formation and organization of the mitotic spindle during cell division. Chromosomal translocation of this gene with the RARA (retinoic acid receptor, alpha) gene on chromosome 17 have been detected in patients with acute promyelocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out or hypomorphic allele exhibit embryonic lethality by E9.5. [provided by MGI curators]
Allele List at MGI

All alleles(97) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(94)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik C T 2: 68,659,878 probably benign Het
Abl1 T C 2: 31,801,696 Y1076H probably damaging Het
Adamts7 C T 9: 90,194,010 T1265I possibly damaging Het
Adgb T C 10: 10,407,465 I166V probably benign Het
Axin2 T A 11: 108,942,576 I529N possibly damaging Het
Bbof1 T C 12: 84,409,183 M1T probably null Het
BC051142 G T 17: 34,460,283 probably benign Het
Clcc1 A T 3: 108,663,591 Y105F possibly damaging Het
Cmpk2 G T 12: 26,469,571 A74S probably benign Het
Colgalt1 G A 8: 71,622,706 V419I probably benign Het
Crybg3 A G 16: 59,544,051 S2403P probably damaging Het
D930048N14Rik G A 11: 51,654,805 probably benign Het
Dnah7b T A 1: 46,137,418 C733S possibly damaging Het
Drc1 G A 5: 30,347,146 V211M possibly damaging Het
Ephx2 T C 14: 66,084,944 T525A probably damaging Het
Eya4 A G 10: 23,226,800 probably null Het
Foxc1 T C 13: 31,807,707 F167S probably damaging Het
Fsip2 C T 2: 82,975,149 T604I probably damaging Het
Gm6370 C A 5: 146,493,924 F306L possibly damaging Het
Hmgcr A G 13: 96,660,221 V187A probably damaging Het
Igkv9-129 T A 6: 67,840,258 S114R possibly damaging Het
Ikbke T A 1: 131,263,348 I519F probably damaging Het
Ikzf3 T C 11: 98,490,487 Y89C probably benign Het
Inpp5j T G 11: 3,501,107 H514P probably damaging Het
Iqsec3 T C 6: 121,413,040 probably benign Het
Itga3 C A 11: 95,062,623 V298L probably benign Het
Kel C T 6: 41,698,425 W297* probably null Het
Larp7 T A 3: 127,546,954 R112S probably benign Het
Lbh T A 17: 72,921,183 probably null Het
Lrba G A 3: 86,360,126 G1708S probably damaging Het
Lrig2 C T 3: 104,467,304 V154I probably benign Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mast4 A T 13: 102,739,205 F1318L probably damaging Het
Ncam2 T C 16: 81,527,103 V545A probably benign Het
Olfr263 A T 13: 21,133,437 I221L possibly damaging Het
Olfr430 G A 1: 174,070,008 A237T probably damaging Het
Pcgf5 C A 19: 36,437,340 N26K possibly damaging Het
Pdlim4 T G 11: 54,055,918 D181A possibly damaging Het
Phtf1 G A 3: 104,003,603 probably null Het
Pik3r4 G A 9: 105,650,758 A437T possibly damaging Het
Proser3 G A 7: 30,546,100 probably benign Het
Rax T A 18: 65,935,081 N318Y unknown Het
Rnf152 A G 1: 105,284,352 V160A probably benign Het
Serpina3a A T 12: 104,118,643 D99V probably benign Het
Sidt2 T C 9: 45,942,775 T652A probably benign Het
Slc12a7 A G 13: 73,814,843 Y1054C probably damaging Het
Slc9a5 A G 8: 105,358,471 N535D possibly damaging Het
Sspo C A 6: 48,464,901 H1948Q probably benign Het
Stap2 G T 17: 55,997,827 Y318* probably null Het
Sytl1 T C 4: 133,253,565 D421G probably damaging Het
Taar7e A T 10: 24,038,034 I141F probably damaging Het
Taar7f T A 10: 24,050,023 W172R probably damaging Het
Tcn2 T C 11: 3,922,114 K338E possibly damaging Het
Tenm3 C T 8: 48,349,404 G374D probably damaging Het
Terf2 A G 8: 107,079,448 S291P probably damaging Het
Tex16 T A X: 112,120,943 D1046E probably benign Het
Tmod4 A G 3: 95,127,829 D215G probably benign Het
Tnxb T C 17: 34,710,977 I2895T possibly damaging Het
Urgcp C A 11: 5,715,878 G820V probably damaging Het
Uxs1 T A 1: 43,750,238 H419L possibly damaging Het
Vmn1r152 A T 7: 22,523,579 T205S possibly damaging Het
Vmn1r79 A G 7: 12,176,488 Y99C possibly damaging Het
Zc3h14 A G 12: 98,785,399 H199R probably damaging Het
Zfand2b A T 1: 75,169,810 M110L probably benign Het
Zfp976 A G 7: 42,616,325 F12S probably damaging Het
Other mutations in Numa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Numa1 APN 7 102013286 missense possibly damaging 0.95
IGL00819:Numa1 APN 7 101992710 missense possibly damaging 0.90
IGL01103:Numa1 APN 7 102001571 missense probably benign 0.01
IGL01153:Numa1 APN 7 101994744 missense probably damaging 1.00
IGL01954:Numa1 APN 7 101996093 nonsense probably null
IGL02114:Numa1 APN 7 102011876 unclassified probably benign
IGL02245:Numa1 APN 7 102000394 missense probably benign 0.02
IGL02259:Numa1 APN 7 101987748 missense possibly damaging 0.93
IGL02313:Numa1 APN 7 102000232 nonsense probably null
IGL02316:Numa1 APN 7 102001370 missense probably damaging 1.00
IGL02386:Numa1 APN 7 102007532 missense probably benign 0.00
IGL02517:Numa1 APN 7 102012009 missense probably benign 0.01
IGL02529:Numa1 APN 7 101999953 splice site probably null
IGL02664:Numa1 APN 7 101998902 missense possibly damaging 0.83
IGL02721:Numa1 APN 7 101999911 missense probably benign 0.01
IGL02816:Numa1 APN 7 101996100 missense probably damaging 1.00
IGL03126:Numa1 APN 7 102000667 nonsense probably null
meltdown UTSW 7 101990571 critical splice acceptor site probably null
1mM(1):Numa1 UTSW 7 101994715 missense probably benign 0.06
PIT4651001:Numa1 UTSW 7 102013934 missense probably damaging 0.97
R0047:Numa1 UTSW 7 102009453 missense probably damaging 1.00
R0047:Numa1 UTSW 7 102009453 missense probably damaging 1.00
R0548:Numa1 UTSW 7 101995524 missense possibly damaging 0.86
R0554:Numa1 UTSW 7 101995524 missense possibly damaging 0.86
R0592:Numa1 UTSW 7 102013897 missense probably benign
R0669:Numa1 UTSW 7 101999677 missense probably benign
R0856:Numa1 UTSW 7 101998948 missense probably damaging 1.00
R1072:Numa1 UTSW 7 102001150 splice site probably null
R1776:Numa1 UTSW 7 102011050 missense probably damaging 1.00
R1898:Numa1 UTSW 7 101992720 critical splice donor site probably null
R1969:Numa1 UTSW 7 102009322 missense probably damaging 0.98
R1970:Numa1 UTSW 7 102009322 missense probably damaging 0.98
R1971:Numa1 UTSW 7 102009322 missense probably damaging 0.98
R2180:Numa1 UTSW 7 101999990 missense probably benign 0.00
R2256:Numa1 UTSW 7 102000791 missense probably damaging 0.99
R2257:Numa1 UTSW 7 102000791 missense probably damaging 0.99
R2508:Numa1 UTSW 7 101995524 missense possibly damaging 0.86
R2958:Numa1 UTSW 7 102009495 missense possibly damaging 0.92
R4211:Numa1 UTSW 7 102009738 missense probably damaging 1.00
R4643:Numa1 UTSW 7 102000665 splice site probably null
R4783:Numa1 UTSW 7 102013566 missense probably damaging 1.00
R4823:Numa1 UTSW 7 101996037 missense probably damaging 1.00
R4908:Numa1 UTSW 7 102012805 missense probably damaging 1.00
R4934:Numa1 UTSW 7 102010857 missense probably benign 0.32
R4981:Numa1 UTSW 7 101992674 missense probably damaging 1.00
R5120:Numa1 UTSW 7 101977437 missense probably damaging 0.99
R5122:Numa1 UTSW 7 102013769 missense probably damaging 1.00
R5210:Numa1 UTSW 7 101999981 missense probably benign 0.03
R5230:Numa1 UTSW 7 101995524 missense possibly damaging 0.86
R5547:Numa1 UTSW 7 102013930 missense probably damaging 1.00
R5861:Numa1 UTSW 7 102009287 splice site probably null
R6006:Numa1 UTSW 7 101992719 critical splice donor site probably null
R6031:Numa1 UTSW 7 102012012 missense possibly damaging 0.86
R6031:Numa1 UTSW 7 102012012 missense possibly damaging 0.86
R6295:Numa1 UTSW 7 102000767 missense probably benign 0.03
R6322:Numa1 UTSW 7 102000920 missense probably damaging 1.00
R6413:Numa1 UTSW 7 101990571 critical splice acceptor site probably null
R6786:Numa1 UTSW 7 101992638 missense probably benign 0.05
R7218:Numa1 UTSW 7 102000910 missense probably benign 0.02
R7312:Numa1 UTSW 7 101990599 missense possibly damaging 0.92
R7374:Numa1 UTSW 7 102009128 missense probably benign 0.00
R7626:Numa1 UTSW 7 101999423 missense probably benign 0.42
R7769:Numa1 UTSW 7 101999000 missense possibly damaging 0.77
R7830:Numa1 UTSW 7 101999285 missense probably benign 0.03
R7886:Numa1 UTSW 7 102013865 missense probably benign 0.27
R7935:Numa1 UTSW 7 102002331 missense probably damaging 0.96
R8134:Numa1 UTSW 7 102001627 missense probably benign 0.14
R8143:Numa1 UTSW 7 101999684 missense possibly damaging 0.82
R8217:Numa1 UTSW 7 101992669 missense possibly damaging 0.66
R8263:Numa1 UTSW 7 101999284 missense probably benign 0.03
R8536:Numa1 UTSW 7 102001580 missense probably damaging 0.96
R8677:Numa1 UTSW 7 102000941 missense probably damaging 0.99
R8683:Numa1 UTSW 7 101977410 start codon destroyed probably null 0.09
R8786:Numa1 UTSW 7 101998409 missense probably benign 0.45
R8855:Numa1 UTSW 7 101990628 missense possibly damaging 0.92
R8881:Numa1 UTSW 7 102001477 missense probably benign 0.01
RF013:Numa1 UTSW 7 101999780 missense probably damaging 0.99
Z1088:Numa1 UTSW 7 101998331 missense probably damaging 0.99
Z1088:Numa1 UTSW 7 101998402 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- AGGAAGCTGAACAGACCTGC -3'
(R):5'- CAAGGCTTTCCTAACTGCCC -3'

Sequencing Primer
(F):5'- GACCTGCCGTCACCTTACAG -3'
(R):5'- TCCTAACTGCCCCACCTCAC -3'
Posted On2015-06-10