Incidental Mutation 'R4210:Terf2'
ID319132
Institutional Source Beutler Lab
Gene Symbol Terf2
Ensembl Gene ENSMUSG00000031921
Gene Nametelomeric repeat binding factor 2
SynonymsTRF2
MMRRC Submission 041039-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4210 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location107069400-107096547 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107079448 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 291 (S291P)
Ref Sequence ENSEMBL: ENSMUSP00000118759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068388] [ENSMUST00000068421] [ENSMUST00000116425] [ENSMUST00000133925]
Predicted Effect probably damaging
Transcript: ENSMUST00000068388
AA Change: S291P

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000065586
Gene: ENSMUSG00000031921
AA Change: S291P

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
low complexity region 47 75 N/A INTRINSIC
low complexity region 77 96 N/A INTRINSIC
Pfam:TRF 97 297 7.5e-39 PFAM
PDB:3K6G|F 318 356 2e-12 PDB
SANT 422 473 1.71e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000068421
AA Change: S291P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000068948
Gene: ENSMUSG00000031921
AA Change: S291P

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
low complexity region 47 75 N/A INTRINSIC
low complexity region 77 96 N/A INTRINSIC
Pfam:TRF 97 296 3e-38 PFAM
Pfam:TERF2_RBM 320 360 5.1e-22 PFAM
SANT 487 538 1.71e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000116425
AA Change: S291P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112126
Gene: ENSMUSG00000031921
AA Change: S291P

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
low complexity region 47 75 N/A INTRINSIC
low complexity region 77 96 N/A INTRINSIC
Pfam:TRF 97 297 1.5e-38 PFAM
PDB:3K6G|F 319 359 4e-14 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000133925
AA Change: S291P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118759
Gene: ENSMUSG00000031921
AA Change: S291P

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
low complexity region 47 75 N/A INTRINSIC
low complexity region 77 96 N/A INTRINSIC
Pfam:TRF 97 297 9.9e-39 PFAM
PDB:3K6G|F 318 358 3e-14 PDB
SANT 486 537 1.71e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136178
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141205
Predicted Effect probably benign
Transcript: ENSMUST00000142616
SMART Domains Protein: ENSMUSP00000118589
Gene: ENSMUSG00000031921

DomainStartEndE-ValueType
Pfam:TRF 1 178 2.6e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155834
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a telomere specific protein, TERF2, which is a component of the telomere nucleoprotein complex. This protein is present at telomeres in metaphase of the cell cycle, is a second negative regulator of telomere length and plays a key role in the protective activity of telomeres. While having similar telomere binding activity and domain organization, TERF2 differs from TERF1 in that its N terminus is basic rather than acidic. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik C T 2: 68,659,878 probably benign Het
Abl1 T C 2: 31,801,696 Y1076H probably damaging Het
Adamts7 C T 9: 90,194,010 T1265I possibly damaging Het
Adgb T C 10: 10,407,465 I166V probably benign Het
Axin2 T A 11: 108,942,576 I529N possibly damaging Het
Bbof1 T C 12: 84,409,183 M1T probably null Het
BC051142 G T 17: 34,460,283 probably benign Het
Clcc1 A T 3: 108,663,591 Y105F possibly damaging Het
Cmpk2 G T 12: 26,469,571 A74S probably benign Het
Colgalt1 G A 8: 71,622,706 V419I probably benign Het
Crybg3 A G 16: 59,544,051 S2403P probably damaging Het
D930048N14Rik G A 11: 51,654,805 probably benign Het
Dnah7b T A 1: 46,137,418 C733S possibly damaging Het
Drc1 G A 5: 30,347,146 V211M possibly damaging Het
Ephx2 T C 14: 66,084,944 T525A probably damaging Het
Eya4 A G 10: 23,226,800 probably null Het
Foxc1 T C 13: 31,807,707 F167S probably damaging Het
Fsip2 C T 2: 82,975,149 T604I probably damaging Het
Gm6370 C A 5: 146,493,924 F306L possibly damaging Het
Hmgcr A G 13: 96,660,221 V187A probably damaging Het
Igkv9-129 T A 6: 67,840,258 S114R possibly damaging Het
Ikbke T A 1: 131,263,348 I519F probably damaging Het
Ikzf3 T C 11: 98,490,487 Y89C probably benign Het
Inpp5j T G 11: 3,501,107 H514P probably damaging Het
Iqsec3 T C 6: 121,413,040 probably benign Het
Itga3 C A 11: 95,062,623 V298L probably benign Het
Kel C T 6: 41,698,425 W297* probably null Het
Larp7 T A 3: 127,546,954 R112S probably benign Het
Lbh T A 17: 72,921,183 probably null Het
Lrba G A 3: 86,360,126 G1708S probably damaging Het
Lrig2 C T 3: 104,467,304 V154I probably benign Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mast4 A T 13: 102,739,205 F1318L probably damaging Het
Ncam2 T C 16: 81,527,103 V545A probably benign Het
Numa1 T G 7: 102,009,738 L356R probably damaging Het
Olfr263 A T 13: 21,133,437 I221L possibly damaging Het
Olfr430 G A 1: 174,070,008 A237T probably damaging Het
Pcgf5 C A 19: 36,437,340 N26K possibly damaging Het
Pdlim4 T G 11: 54,055,918 D181A possibly damaging Het
Phtf1 G A 3: 104,003,603 probably null Het
Pik3r4 G A 9: 105,650,758 A437T possibly damaging Het
Proser3 G A 7: 30,546,100 probably benign Het
Rax T A 18: 65,935,081 N318Y unknown Het
Rnf152 A G 1: 105,284,352 V160A probably benign Het
Serpina3a A T 12: 104,118,643 D99V probably benign Het
Sidt2 T C 9: 45,942,775 T652A probably benign Het
Slc12a7 A G 13: 73,814,843 Y1054C probably damaging Het
Slc9a5 A G 8: 105,358,471 N535D possibly damaging Het
Sspo C A 6: 48,464,901 H1948Q probably benign Het
Stap2 G T 17: 55,997,827 Y318* probably null Het
Sytl1 T C 4: 133,253,565 D421G probably damaging Het
Taar7e A T 10: 24,038,034 I141F probably damaging Het
Taar7f T A 10: 24,050,023 W172R probably damaging Het
Tcn2 T C 11: 3,922,114 K338E possibly damaging Het
Tenm3 C T 8: 48,349,404 G374D probably damaging Het
Tex16 T A X: 112,120,943 D1046E probably benign Het
Tmod4 A G 3: 95,127,829 D215G probably benign Het
Tnxb T C 17: 34,710,977 I2895T possibly damaging Het
Urgcp C A 11: 5,715,878 G820V probably damaging Het
Uxs1 T A 1: 43,750,238 H419L possibly damaging Het
Vmn1r152 A T 7: 22,523,579 T205S possibly damaging Het
Vmn1r79 A G 7: 12,176,488 Y99C possibly damaging Het
Zc3h14 A G 12: 98,785,399 H199R probably damaging Het
Zfand2b A T 1: 75,169,810 M110L probably benign Het
Zfp976 A G 7: 42,616,325 F12S probably damaging Het
Other mutations in Terf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02823:Terf2 APN 8 107072625 missense possibly damaging 0.89
IGL02879:Terf2 APN 8 107076697 missense probably benign 0.02
IGL03368:Terf2 APN 8 107070549 missense probably damaging 1.00
PIT1430001:Terf2 UTSW 8 107096302 missense probably damaging 0.98
R0454:Terf2 UTSW 8 107096210 nonsense probably null
R0615:Terf2 UTSW 8 107082990 missense possibly damaging 0.90
R1983:Terf2 UTSW 8 107083008 missense probably damaging 0.99
R3051:Terf2 UTSW 8 107079384 missense possibly damaging 0.88
R3053:Terf2 UTSW 8 107079384 missense possibly damaging 0.88
R4782:Terf2 UTSW 8 107076675 missense probably benign 0.00
R4799:Terf2 UTSW 8 107076675 missense probably benign 0.00
R4994:Terf2 UTSW 8 107076478 intron probably benign
R6414:Terf2 UTSW 8 107076854 missense probably benign 0.01
R6777:Terf2 UTSW 8 107070537 missense possibly damaging 0.95
R7315:Terf2 UTSW 8 107081217 missense probably benign 0.03
R7481:Terf2 UTSW 8 107072721 critical splice donor site probably null
R8165:Terf2 UTSW 8 107083024 missense possibly damaging 0.83
T0722:Terf2 UTSW 8 107076674 missense probably benign
Z1088:Terf2 UTSW 8 107081223 missense probably damaging 1.00
Z1177:Terf2 UTSW 8 107096295 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAGTTCTCTGCCTCTCAAAGTG -3'
(R):5'- CTGCCTAGAGCTTACTGTGTAG -3'

Sequencing Primer
(F):5'- GTGTGATATGCCAACAACCTG -3'
(R):5'- CAGAACTGAATGCTGAGACCTTGTC -3'
Posted On2015-06-10