Incidental Mutation 'R4210:Adamts7'
ID319134
Institutional Source Beutler Lab
Gene Symbol Adamts7
Ensembl Gene ENSMUSG00000032363
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 7
SynonymsADAM-TS7
MMRRC Submission 041039-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R4210 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location90163069-90208071 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 90194010 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 1265 (T1265I)
Ref Sequence ENSEMBL: ENSMUSP00000108683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113059] [ENSMUST00000113060] [ENSMUST00000134996] [ENSMUST00000147250] [ENSMUST00000167122]
Predicted Effect possibly damaging
Transcript: ENSMUST00000113059
AA Change: T1307I

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108682
Gene: ENSMUSG00000032363
AA Change: T1307I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Pep_M12B_propep 34 174 1.1e-36 PFAM
low complexity region 203 220 N/A INTRINSIC
Pfam:Reprolysin_5 224 411 1.3e-16 PFAM
Pfam:Reprolysin_4 224 425 8.5e-9 PFAM
Pfam:Reprolysin 226 437 2.2e-27 PFAM
Pfam:Reprolysin_2 244 427 2.9e-12 PFAM
Pfam:Reprolysin_3 248 383 5.2e-13 PFAM
Blast:ACR 442 513 5e-15 BLAST
TSP1 526 578 4.9e-13 SMART
Pfam:ADAM_spacer1 683 794 2.2e-36 PFAM
TSP1 807 863 1.45e-6 SMART
TSP1 866 908 2.41e-1 SMART
TSP1 929 978 1.45e-6 SMART
low complexity region 1011 1025 N/A INTRINSIC
low complexity region 1211 1233 N/A INTRINSIC
TSP1 1385 1435 2.4e-2 SMART
TSP1 1436 1493 1.8e-2 SMART
TSP1 1495 1542 4.82e-2 SMART
TSP1 1543 1600 1.39e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113060
AA Change: T1265I

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108683
Gene: ENSMUSG00000032363
AA Change: T1265I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Pep_M12B_propep 33 174 3.4e-28 PFAM
low complexity region 203 220 N/A INTRINSIC
Pfam:Reprolysin_5 224 411 1.6e-16 PFAM
Pfam:Reprolysin_4 224 425 8.2e-9 PFAM
Pfam:Reprolysin 226 437 6.4e-30 PFAM
Pfam:Reprolysin_2 244 427 4.6e-12 PFAM
Pfam:Reprolysin_3 248 383 8.1e-13 PFAM
Blast:ACR 442 513 5e-15 BLAST
TSP1 526 578 4.9e-13 SMART
Pfam:ADAM_spacer1 683 794 1.5e-36 PFAM
TSP1 807 863 1.45e-6 SMART
TSP1 866 908 2.41e-1 SMART
low complexity region 969 983 N/A INTRINSIC
low complexity region 1169 1191 N/A INTRINSIC
TSP1 1343 1393 2.4e-2 SMART
TSP1 1394 1451 1.8e-2 SMART
TSP1 1453 1500 4.82e-2 SMART
TSP1 1501 1558 1.39e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124441
Predicted Effect probably benign
Transcript: ENSMUST00000134996
SMART Domains Protein: ENSMUSP00000119744
Gene: ENSMUSG00000032363

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Pep_M12B_propep 33 174 2.4e-29 PFAM
low complexity region 203 220 N/A INTRINSIC
Pfam:Reprolysin_5 224 412 1e-17 PFAM
Pfam:Reprolysin_4 224 426 5e-10 PFAM
Pfam:Reprolysin 226 437 3.7e-31 PFAM
Pfam:Reprolysin_2 244 427 3.2e-13 PFAM
Pfam:Reprolysin_3 248 383 6.3e-14 PFAM
Blast:ACR 439 505 7e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144943
Predicted Effect probably benign
Transcript: ENSMUST00000147250
SMART Domains Protein: ENSMUSP00000115972
Gene: ENSMUSG00000032363

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Pep_M12B_propep 33 174 2.7e-26 PFAM
low complexity region 203 220 N/A INTRINSIC
Pfam:Reprolysin_5 224 411 1.4e-14 PFAM
Pfam:Reprolysin_4 224 425 7e-7 PFAM
Pfam:Reprolysin 226 437 4.9e-28 PFAM
Pfam:Reprolysin_2 244 427 5e-10 PFAM
Pfam:Reprolysin_3 248 383 6.5e-11 PFAM
ACR 439 515 1.7e-5 SMART
TSP1 526 578 2.3e-15 SMART
Pfam:ADAM_spacer1 683 794 3.5e-34 PFAM
TSP1 807 863 6.9e-9 SMART
TSP1 866 908 1.2e-3 SMART
low complexity region 969 983 N/A INTRINSIC
low complexity region 1169 1191 N/A INTRINSIC
TSP1 1284 1334 1.2e-4 SMART
TSP1 1335 1392 8.7e-5 SMART
TSP1 1394 1441 2.3e-4 SMART
TSP1 1442 1499 6.5e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000167122
AA Change: T1307I

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000129292
Gene: ENSMUSG00000032363
AA Change: T1307I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Pep_M12B_propep 33 174 1.4e-28 PFAM
low complexity region 203 220 N/A INTRINSIC
Pfam:Reprolysin_5 224 411 7.2e-17 PFAM
Pfam:Reprolysin_4 224 425 3.6e-9 PFAM
Pfam:Reprolysin 226 437 2.9e-30 PFAM
Pfam:Reprolysin_2 244 427 2.2e-12 PFAM
Pfam:Reprolysin_3 248 383 3.7e-13 PFAM
Blast:ACR 442 513 5e-15 BLAST
TSP1 526 578 4.9e-13 SMART
Pfam:ADAM_spacer1 683 794 1.1e-36 PFAM
TSP1 807 863 1.45e-6 SMART
TSP1 866 908 2.41e-1 SMART
TSP1 929 978 1.45e-6 SMART
low complexity region 1011 1025 N/A INTRINSIC
low complexity region 1211 1233 N/A INTRINSIC
TSP1 1385 1435 2.4e-2 SMART
TSP1 1436 1493 1.8e-2 SMART
TSP1 1495 1542 4.82e-2 SMART
TSP1 1543 1600 1.39e-3 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active, zinc-dependent enzyme that degrades cartilage oligomeric matrix protein. The deficiency of the encoded protein decreases atherosclerosis in genetically hyperlipidemic mice and in response to vascular injury. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygotes for a null allele show increased lung function parameters, reduced endothelial cell migration and proliferation, increased re-endothelialization and ameliorated neointima formation after carotid artery injury, and increased oval cell activation and biliary fibrosis after liver injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik C T 2: 68,659,878 probably benign Het
Abl1 T C 2: 31,801,696 Y1076H probably damaging Het
Adgb T C 10: 10,407,465 I166V probably benign Het
Axin2 T A 11: 108,942,576 I529N possibly damaging Het
Bbof1 T C 12: 84,409,183 M1T probably null Het
BC051142 G T 17: 34,460,283 probably benign Het
Clcc1 A T 3: 108,663,591 Y105F possibly damaging Het
Cmpk2 G T 12: 26,469,571 A74S probably benign Het
Colgalt1 G A 8: 71,622,706 V419I probably benign Het
Crybg3 A G 16: 59,544,051 S2403P probably damaging Het
D930048N14Rik G A 11: 51,654,805 probably benign Het
Dnah7b T A 1: 46,137,418 C733S possibly damaging Het
Drc1 G A 5: 30,347,146 V211M possibly damaging Het
Ephx2 T C 14: 66,084,944 T525A probably damaging Het
Eya4 A G 10: 23,226,800 probably null Het
Foxc1 T C 13: 31,807,707 F167S probably damaging Het
Fsip2 C T 2: 82,975,149 T604I probably damaging Het
Gm6370 C A 5: 146,493,924 F306L possibly damaging Het
Hmgcr A G 13: 96,660,221 V187A probably damaging Het
Igkv9-129 T A 6: 67,840,258 S114R possibly damaging Het
Ikbke T A 1: 131,263,348 I519F probably damaging Het
Ikzf3 T C 11: 98,490,487 Y89C probably benign Het
Inpp5j T G 11: 3,501,107 H514P probably damaging Het
Iqsec3 T C 6: 121,413,040 probably benign Het
Itga3 C A 11: 95,062,623 V298L probably benign Het
Kel C T 6: 41,698,425 W297* probably null Het
Larp7 T A 3: 127,546,954 R112S probably benign Het
Lbh T A 17: 72,921,183 probably null Het
Lrba G A 3: 86,360,126 G1708S probably damaging Het
Lrig2 C T 3: 104,467,304 V154I probably benign Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mast4 A T 13: 102,739,205 F1318L probably damaging Het
Ncam2 T C 16: 81,527,103 V545A probably benign Het
Numa1 T G 7: 102,009,738 L356R probably damaging Het
Olfr263 A T 13: 21,133,437 I221L possibly damaging Het
Olfr430 G A 1: 174,070,008 A237T probably damaging Het
Pcgf5 C A 19: 36,437,340 N26K possibly damaging Het
Pdlim4 T G 11: 54,055,918 D181A possibly damaging Het
Phtf1 G A 3: 104,003,603 probably null Het
Pik3r4 G A 9: 105,650,758 A437T possibly damaging Het
Proser3 G A 7: 30,546,100 probably benign Het
Rax T A 18: 65,935,081 N318Y unknown Het
Rnf152 A G 1: 105,284,352 V160A probably benign Het
Serpina3a A T 12: 104,118,643 D99V probably benign Het
Sidt2 T C 9: 45,942,775 T652A probably benign Het
Slc12a7 A G 13: 73,814,843 Y1054C probably damaging Het
Slc9a5 A G 8: 105,358,471 N535D possibly damaging Het
Sspo C A 6: 48,464,901 H1948Q probably benign Het
Stap2 G T 17: 55,997,827 Y318* probably null Het
Sytl1 T C 4: 133,253,565 D421G probably damaging Het
Taar7e A T 10: 24,038,034 I141F probably damaging Het
Taar7f T A 10: 24,050,023 W172R probably damaging Het
Tcn2 T C 11: 3,922,114 K338E possibly damaging Het
Tenm3 C T 8: 48,349,404 G374D probably damaging Het
Terf2 A G 8: 107,079,448 S291P probably damaging Het
Tex16 T A X: 112,120,943 D1046E probably benign Het
Tmod4 A G 3: 95,127,829 D215G probably benign Het
Tnxb T C 17: 34,710,977 I2895T possibly damaging Het
Urgcp C A 11: 5,715,878 G820V probably damaging Het
Uxs1 T A 1: 43,750,238 H419L possibly damaging Het
Vmn1r152 A T 7: 22,523,579 T205S possibly damaging Het
Vmn1r79 A G 7: 12,176,488 Y99C possibly damaging Het
Zc3h14 A G 12: 98,785,399 H199R probably damaging Het
Zfand2b A T 1: 75,169,810 M110L probably benign Het
Zfp976 A G 7: 42,616,325 F12S probably damaging Het
Other mutations in Adamts7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Adamts7 APN 9 90194249 missense possibly damaging 0.71
IGL00673:Adamts7 APN 9 90193661 missense possibly damaging 0.78
IGL00902:Adamts7 APN 9 90188794 critical splice donor site probably null
IGL01303:Adamts7 APN 9 90171734 missense possibly damaging 0.46
IGL01333:Adamts7 APN 9 90186979 missense probably damaging 1.00
IGL01431:Adamts7 APN 9 90207785 missense possibly damaging 0.89
IGL01595:Adamts7 APN 9 90193306 missense probably benign 0.02
IGL02728:Adamts7 APN 9 90191827 splice site probably benign
IGL02860:Adamts7 APN 9 90191862 missense probably benign
IGL03237:Adamts7 APN 9 90188664 missense probably damaging 1.00
PIT4495001:Adamts7 UTSW 9 90174622 missense probably damaging 1.00
R0044:Adamts7 UTSW 9 90171588 missense possibly damaging 0.58
R0078:Adamts7 UTSW 9 90179411 missense probably damaging 1.00
R0107:Adamts7 UTSW 9 90180720 missense possibly damaging 0.82
R0122:Adamts7 UTSW 9 90179421 missense probably damaging 1.00
R0166:Adamts7 UTSW 9 90193692 missense probably benign 0.00
R0517:Adamts7 UTSW 9 90199858 missense probably benign 0.01
R1442:Adamts7 UTSW 9 90188770 missense probably damaging 0.99
R1468:Adamts7 UTSW 9 90188798 splice site probably benign
R1554:Adamts7 UTSW 9 90173650 missense probably damaging 1.00
R1612:Adamts7 UTSW 9 90188697 missense possibly damaging 0.86
R1652:Adamts7 UTSW 9 90189644 missense probably damaging 1.00
R2007:Adamts7 UTSW 9 90177856 missense probably damaging 1.00
R2091:Adamts7 UTSW 9 90188440 critical splice donor site probably null
R2202:Adamts7 UTSW 9 90180676 missense probably damaging 1.00
R2204:Adamts7 UTSW 9 90180676 missense probably damaging 1.00
R2205:Adamts7 UTSW 9 90180676 missense probably damaging 1.00
R2305:Adamts7 UTSW 9 90180711 missense probably benign 0.39
R2409:Adamts7 UTSW 9 90180687 missense probably damaging 1.00
R4157:Adamts7 UTSW 9 90188361 missense probably damaging 1.00
R4368:Adamts7 UTSW 9 90195851 critical splice donor site probably null
R4533:Adamts7 UTSW 9 90180708 missense probably damaging 1.00
R4608:Adamts7 UTSW 9 90174540 missense probably damaging 1.00
R4623:Adamts7 UTSW 9 90186462 missense probably benign 0.17
R4661:Adamts7 UTSW 9 90193330 missense probably benign 0.02
R4820:Adamts7 UTSW 9 90189686 missense possibly damaging 0.62
R4942:Adamts7 UTSW 9 90163311 missense probably benign
R4961:Adamts7 UTSW 9 90185740 missense probably damaging 1.00
R5064:Adamts7 UTSW 9 90195830 missense probably damaging 1.00
R5763:Adamts7 UTSW 9 90188409 missense probably damaging 1.00
R5921:Adamts7 UTSW 9 90188694 missense probably benign 0.20
R6027:Adamts7 UTSW 9 90191025 missense probably damaging 1.00
R6182:Adamts7 UTSW 9 90192436 missense probably benign 0.01
R6306:Adamts7 UTSW 9 90178278 critical splice donor site probably null
R6404:Adamts7 UTSW 9 90180456 intron probably null
R6488:Adamts7 UTSW 9 90171482 missense probably benign 0.00
R6649:Adamts7 UTSW 9 90191937 missense probably damaging 1.00
R6658:Adamts7 UTSW 9 90195300 missense probably damaging 0.99
R6874:Adamts7 UTSW 9 90188731 missense probably damaging 1.00
R6947:Adamts7 UTSW 9 90191804 intron probably null
R7110:Adamts7 UTSW 9 90193964 missense possibly damaging 0.92
R7224:Adamts7 UTSW 9 90185815 missense probably damaging 1.00
R7239:Adamts7 UTSW 9 90186557 splice site probably null
R7519:Adamts7 UTSW 9 90197079 missense probably benign 0.22
R7608:Adamts7 UTSW 9 90173773 missense possibly damaging 0.68
R7635:Adamts7 UTSW 9 90195245 missense probably damaging 1.00
X0028:Adamts7 UTSW 9 90178217 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TGTCGACAGGATGGAATGCG -3'
(R):5'- GCTCTACACAACTCACCTGG -3'

Sequencing Primer
(F):5'- TGGGACCCTGTGCTAGAG -3'
(R):5'- ATTCCTGGCAGGCAGTGGATC -3'
Posted On2015-06-10