Incidental Mutation 'R4211:5830473C10Rik'
ID319187
Institutional Source Beutler Lab
Gene Symbol 5830473C10Rik
Ensembl Gene ENSMUSG00000070690
Gene NameRIKEN cDNA 5830473C10 gene
SynonymsGm17754, ARG
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R4211 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location90561107-90597871 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 90564237 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 63 (V63G)
Ref Sequence ENSEMBL: ENSMUSP00000092198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094615] [ENSMUST00000200765]
Predicted Effect probably damaging
Transcript: ENSMUST00000094615
AA Change: V63G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092198
Gene: ENSMUSG00000070690
AA Change: V63G

DomainStartEndE-ValueType
ALBUMIN 17 207 8.87e-26 SMART
ALBUMIN 214 399 1.45e-53 SMART
ALBUMIN 406 598 7.07e-43 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000200765
AA Change: V63G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144527
Gene: ENSMUSG00000070690
AA Change: V63G

DomainStartEndE-ValueType
ALBUMIN 17 207 4.3e-28 SMART
ALBUMIN 214 355 3.3e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200893
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202112
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T C 10: 10,407,465 I166V probably benign Het
Anapc5 T C 5: 122,817,905 E154G probably benign Het
Anpep A T 7: 79,840,996 Y257* probably null Het
Atp8b1 A T 18: 64,553,047 D688E probably damaging Het
Bub1b C A 2: 118,630,978 H670Q possibly damaging Het
Casp3 G T 8: 46,635,388 D107Y probably damaging Het
Clcc1 A T 3: 108,663,591 Y105F possibly damaging Het
Cr2 A C 1: 195,156,328 L671R probably damaging Het
Cttnbp2 A G 6: 18,427,543 V713A probably damaging Het
Cyp4a31 T C 4: 115,565,013 F65L probably benign Het
Dpysl2 T C 14: 66,815,477 S308G probably damaging Het
Dusp22 A T 13: 30,708,743 I168F probably benign Het
Ecel1 A G 1: 87,152,150 S414P probably damaging Het
Fat2 A G 11: 55,283,984 F1968L probably damaging Het
Fsip2 C T 2: 82,975,149 T604I probably damaging Het
Gatsl2 T C 5: 134,125,944 probably null Het
H2-DMb1 T A 17: 34,155,573 F66I possibly damaging Het
Hgf T C 5: 16,614,993 V574A probably damaging Het
Hoxa7 A T 6: 52,216,625 Y137* probably null Het
Ikbke T A 1: 131,263,348 I519F probably damaging Het
Inpp5j T G 11: 3,501,107 H514P probably damaging Het
Kmt2d A G 15: 98,840,189 probably benign Het
Larp7 T A 3: 127,546,954 R112S probably benign Het
Lepr C T 4: 101,733,414 A63V probably benign Het
Lmx1a G T 1: 167,832,859 V238L probably damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mcmbp T C 7: 128,716,005 E172G possibly damaging Het
Mcpt8 G A 14: 56,083,918 H30Y probably damaging Het
Nek8 C A 11: 78,170,483 V379L probably benign Het
Numa1 T G 7: 102,009,738 L356R probably damaging Het
Pard6b C T 2: 168,099,023 A310V probably benign Het
Pcgf5 C A 19: 36,437,340 N26K possibly damaging Het
Phtf1 G A 3: 104,003,603 probably null Het
Plch1 C A 3: 63,711,219 D675Y probably damaging Het
Plk2 A G 13: 110,396,337 H144R probably damaging Het
Rax T A 18: 65,935,081 N318Y unknown Het
Slc9a5 A G 8: 105,358,471 N535D possibly damaging Het
Smarcd2 T A 11: 106,266,905 K138* probably null Het
Taar7e A T 10: 24,038,034 I141F probably damaging Het
Taar7f T A 10: 24,050,023 W172R probably damaging Het
Tango6 A G 8: 106,689,224 I226V probably benign Het
Tcn2 T C 11: 3,922,114 K338E possibly damaging Het
Tdp1 C A 12: 99,898,329 A243E probably damaging Het
Tfpt A G 7: 3,620,387 Y240H probably damaging Het
Tmod4 A G 3: 95,127,829 D215G probably benign Het
Top3b A G 16: 16,882,532 probably null Het
Urgcp C A 11: 5,715,878 G820V probably damaging Het
Zfand2b A T 1: 75,169,810 M110L probably benign Het
Zfyve1 A T 12: 83,575,135 V162E probably damaging Het
Other mutations in 5830473C10Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02216:5830473C10Rik APN 5 90579579 unclassified probably benign
IGL02343:5830473C10Rik APN 5 90579614 missense probably damaging 0.99
IGL02749:5830473C10Rik APN 5 90571765 missense possibly damaging 0.84
IGL02956:5830473C10Rik APN 5 90579638 missense possibly damaging 0.46
R0097:5830473C10Rik UTSW 5 90584936 missense probably benign 0.02
R0097:5830473C10Rik UTSW 5 90584936 missense probably benign 0.02
R0513:5830473C10Rik UTSW 5 90577927 missense probably benign 0.00
R0551:5830473C10Rik UTSW 5 90572719 missense probably damaging 1.00
R1508:5830473C10Rik UTSW 5 90581921 missense probably benign 0.00
R1797:5830473C10Rik UTSW 5 90579601 missense probably damaging 0.99
R2205:5830473C10Rik UTSW 5 90569562 missense possibly damaging 0.50
R2323:5830473C10Rik UTSW 5 90584852 nonsense probably null
R2440:5830473C10Rik UTSW 5 90572689 critical splice acceptor site probably null
R4074:5830473C10Rik UTSW 5 90592868 splice site probably null
R4426:5830473C10Rik UTSW 5 90572783 missense probably damaging 1.00
R4625:5830473C10Rik UTSW 5 90571752 missense probably damaging 0.99
R4823:5830473C10Rik UTSW 5 90566503 missense probably benign 0.01
R4922:5830473C10Rik UTSW 5 90579711 missense possibly damaging 0.84
R4923:5830473C10Rik UTSW 5 90561299 missense probably benign 0.07
R5218:5830473C10Rik UTSW 5 90581918 missense probably benign 0.34
R5267:5830473C10Rik UTSW 5 90584857 missense probably damaging 0.99
R5447:5830473C10Rik UTSW 5 90584310 missense probably damaging 1.00
R5737:5830473C10Rik UTSW 5 90572783 missense probably damaging 1.00
R5966:5830473C10Rik UTSW 5 90571687 missense probably damaging 1.00
R6045:5830473C10Rik UTSW 5 90584989 missense possibly damaging 0.86
R6290:5830473C10Rik UTSW 5 90593005 critical splice donor site probably null
R6799:5830473C10Rik UTSW 5 90579615 missense probably damaging 0.99
R6923:5830473C10Rik UTSW 5 90577793 missense probably benign 0.32
R7088:5830473C10Rik UTSW 5 90572750 nonsense probably null
R7238:5830473C10Rik UTSW 5 90579660 missense probably damaging 1.00
R7319:5830473C10Rik UTSW 5 90571766 critical splice donor site probably null
R7631:5830473C10Rik UTSW 5 90579672 missense probably damaging 1.00
R7798:5830473C10Rik UTSW 5 90597511 missense possibly damaging 0.72
R7821:5830473C10Rik UTSW 5 90592888 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ATGTCAGTGGGCAGGATCAC -3'
(R):5'- GCAATGTTCTGCCTACTTATTCAAC -3'

Sequencing Primer
(F):5'- TCACCTGGAGGAGAACTTAGGAGTC -3'
(R):5'- AACCATCTTTTGTTTACCCTCTAGC -3'
Posted On2015-06-10