Incidental Mutation 'R4211:Plk2'
ID319212
Institutional Source Beutler Lab
Gene Symbol Plk2
Ensembl Gene ENSMUSG00000021701
Gene Namepolo like kinase 2
SynonymsSnk
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4211 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location110395046-110400844 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110396337 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 144 (H144R)
Ref Sequence ENSEMBL: ENSMUSP00000022212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022212]
Predicted Effect probably damaging
Transcript: ENSMUST00000022212
AA Change: H144R

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022212
Gene: ENSMUSG00000021701
AA Change: H144R

DomainStartEndE-ValueType
low complexity region 54 62 N/A INTRINSIC
S_TKc 79 331 7.08e-97 SMART
Blast:STYKc 335 383 9e-7 BLAST
low complexity region 448 464 N/A INTRINSIC
Pfam:POLO_box 508 569 2.5e-19 PFAM
Pfam:POLO_box 604 673 1.3e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223756
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224489
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225156
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225340
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the polo family of serine/threonine protein kinases that have a role in normal cell division. This gene is most abundantly expressed in testis, spleen and fetal tissues, and its expression is inducible by serum, suggesting that it may also play an important role in cells undergoing rapid cell division. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Inactivation of this gene results in impaired embryonic growth and placental defects due to increased cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T G 5: 90,564,237 V63G probably damaging Het
Adgb T C 10: 10,407,465 I166V probably benign Het
Anapc5 T C 5: 122,817,905 E154G probably benign Het
Anpep A T 7: 79,840,996 Y257* probably null Het
Atp8b1 A T 18: 64,553,047 D688E probably damaging Het
Bub1b C A 2: 118,630,978 H670Q possibly damaging Het
Casp3 G T 8: 46,635,388 D107Y probably damaging Het
Clcc1 A T 3: 108,663,591 Y105F possibly damaging Het
Cr2 A C 1: 195,156,328 L671R probably damaging Het
Cttnbp2 A G 6: 18,427,543 V713A probably damaging Het
Cyp4a31 T C 4: 115,565,013 F65L probably benign Het
Dpysl2 T C 14: 66,815,477 S308G probably damaging Het
Dusp22 A T 13: 30,708,743 I168F probably benign Het
Ecel1 A G 1: 87,152,150 S414P probably damaging Het
Fat2 A G 11: 55,283,984 F1968L probably damaging Het
Fsip2 C T 2: 82,975,149 T604I probably damaging Het
Gatsl2 T C 5: 134,125,944 probably null Het
H2-DMb1 T A 17: 34,155,573 F66I possibly damaging Het
Hgf T C 5: 16,614,993 V574A probably damaging Het
Hoxa7 A T 6: 52,216,625 Y137* probably null Het
Ikbke T A 1: 131,263,348 I519F probably damaging Het
Inpp5j T G 11: 3,501,107 H514P probably damaging Het
Kmt2d A G 15: 98,840,189 probably benign Het
Larp7 T A 3: 127,546,954 R112S probably benign Het
Lepr C T 4: 101,733,414 A63V probably benign Het
Lmx1a G T 1: 167,832,859 V238L probably damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mcmbp T C 7: 128,716,005 E172G possibly damaging Het
Mcpt8 G A 14: 56,083,918 H30Y probably damaging Het
Nek8 C A 11: 78,170,483 V379L probably benign Het
Numa1 T G 7: 102,009,738 L356R probably damaging Het
Pard6b C T 2: 168,099,023 A310V probably benign Het
Pcgf5 C A 19: 36,437,340 N26K possibly damaging Het
Phtf1 G A 3: 104,003,603 probably null Het
Plch1 C A 3: 63,711,219 D675Y probably damaging Het
Rax T A 18: 65,935,081 N318Y unknown Het
Slc9a5 A G 8: 105,358,471 N535D possibly damaging Het
Smarcd2 T A 11: 106,266,905 K138* probably null Het
Taar7e A T 10: 24,038,034 I141F probably damaging Het
Taar7f T A 10: 24,050,023 W172R probably damaging Het
Tango6 A G 8: 106,689,224 I226V probably benign Het
Tcn2 T C 11: 3,922,114 K338E possibly damaging Het
Tdp1 C A 12: 99,898,329 A243E probably damaging Het
Tfpt A G 7: 3,620,387 Y240H probably damaging Het
Tmod4 A G 3: 95,127,829 D215G probably benign Het
Top3b A G 16: 16,882,532 probably null Het
Urgcp C A 11: 5,715,878 G820V probably damaging Het
Zfand2b A T 1: 75,169,810 M110L probably benign Het
Zfyve1 A T 12: 83,575,135 V162E probably damaging Het
Other mutations in Plk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Plk2 APN 13 110398764 missense probably benign 0.18
IGL00586:Plk2 APN 13 110396378 missense possibly damaging 0.61
IGL00798:Plk2 APN 13 110398034 missense probably benign 0.00
IGL01450:Plk2 APN 13 110396324 missense probably damaging 1.00
IGL01722:Plk2 APN 13 110399442 missense probably benign 0.00
IGL01937:Plk2 APN 13 110399054 missense possibly damaging 0.80
IGL01945:Plk2 APN 13 110399054 missense possibly damaging 0.80
IGL01993:Plk2 APN 13 110399197 missense probably damaging 1.00
IGL02231:Plk2 APN 13 110400069 missense probably benign 0.01
IGL03059:Plk2 APN 13 110399134 missense probably benign 0.42
Mite UTSW 13 110396036 nonsense probably null
R0189:Plk2 UTSW 13 110399463 missense probably damaging 1.00
R0324:Plk2 UTSW 13 110397708 missense probably benign 0.08
R1108:Plk2 UTSW 13 110399489 missense probably damaging 0.99
R1422:Plk2 UTSW 13 110399489 missense probably damaging 0.99
R1513:Plk2 UTSW 13 110400088 missense probably benign 0.45
R2987:Plk2 UTSW 13 110397709 missense probably benign 0.03
R4050:Plk2 UTSW 13 110399866 missense probably damaging 1.00
R4278:Plk2 UTSW 13 110396103 missense probably benign 0.15
R4777:Plk2 UTSW 13 110397773 missense probably benign
R5121:Plk2 UTSW 13 110399424 missense probably benign 0.01
R5677:Plk2 UTSW 13 110399057 missense possibly damaging 0.83
R6240:Plk2 UTSW 13 110399474 missense probably damaging 1.00
R6240:Plk2 UTSW 13 110400034 missense probably damaging 1.00
R6436:Plk2 UTSW 13 110396036 nonsense probably null
R6596:Plk2 UTSW 13 110397762 missense probably benign 0.37
R6776:Plk2 UTSW 13 110399791 missense probably benign
R6938:Plk2 UTSW 13 110396680 nonsense probably null
R7556:Plk2 UTSW 13 110396588 splice site probably null
Z1177:Plk2 UTSW 13 110395259 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TGGGTATGACTGTCGACTAAAG -3'
(R):5'- CATCCCTTTGCTGGACTGAC -3'

Sequencing Primer
(F):5'- CGACTAAAGTATTTTCTTTGTGTGC -3'
(R):5'- TTTGCTGGACTGACGACGC -3'
Posted On2015-06-10