Incidental Mutation 'R4211:Dpysl2'
ID319214
Institutional Source Beutler Lab
Gene Symbol Dpysl2
Ensembl Gene ENSMUSG00000022048
Gene Namedihydropyrimidinase-like 2
SynonymsDRP2, Crmp2, Ulip2, TOAD-64
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.630) question?
Stock #R4211 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location66802864-66868688 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66815477 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 308 (S308G)
Ref Sequence ENSEMBL: ENSMUSP00000022629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022629]
Predicted Effect probably damaging
Transcript: ENSMUST00000022629
AA Change: S308G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022629
Gene: ENSMUSG00000022048
AA Change: S308G

DomainStartEndE-ValueType
Pfam:Amidohydro_1 64 453 4.3e-54 PFAM
Meta Mutation Damage Score 0.1875 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the collapsin response mediator protein family. Collapsin response mediator proteins form homo- and hetero-tetramers and facilitate neuron guidance, growth and polarity. The encoded protein promotes microtubule assembly and is required for Sema3A-mediated growth cone collapse, and also plays a role in synaptic signaling through interactions with calcium channels. This gene has been implicated in multiple neurological disorders, and hyperphosphorylation of the encoded protein may play a key role in the development of Alzheimer's disease. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit abnormal dendritic patterning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T G 5: 90,564,237 V63G probably damaging Het
Adgb T C 10: 10,407,465 I166V probably benign Het
Anapc5 T C 5: 122,817,905 E154G probably benign Het
Anpep A T 7: 79,840,996 Y257* probably null Het
Atp8b1 A T 18: 64,553,047 D688E probably damaging Het
Bub1b C A 2: 118,630,978 H670Q possibly damaging Het
Casp3 G T 8: 46,635,388 D107Y probably damaging Het
Clcc1 A T 3: 108,663,591 Y105F possibly damaging Het
Cr2 A C 1: 195,156,328 L671R probably damaging Het
Cttnbp2 A G 6: 18,427,543 V713A probably damaging Het
Cyp4a31 T C 4: 115,565,013 F65L probably benign Het
Dusp22 A T 13: 30,708,743 I168F probably benign Het
Ecel1 A G 1: 87,152,150 S414P probably damaging Het
Fat2 A G 11: 55,283,984 F1968L probably damaging Het
Fsip2 C T 2: 82,975,149 T604I probably damaging Het
Gatsl2 T C 5: 134,125,944 probably null Het
H2-DMb1 T A 17: 34,155,573 F66I possibly damaging Het
Hgf T C 5: 16,614,993 V574A probably damaging Het
Hoxa7 A T 6: 52,216,625 Y137* probably null Het
Ikbke T A 1: 131,263,348 I519F probably damaging Het
Inpp5j T G 11: 3,501,107 H514P probably damaging Het
Kmt2d A G 15: 98,840,189 probably benign Het
Larp7 T A 3: 127,546,954 R112S probably benign Het
Lepr C T 4: 101,733,414 A63V probably benign Het
Lmx1a G T 1: 167,832,859 V238L probably damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mcmbp T C 7: 128,716,005 E172G possibly damaging Het
Mcpt8 G A 14: 56,083,918 H30Y probably damaging Het
Nek8 C A 11: 78,170,483 V379L probably benign Het
Numa1 T G 7: 102,009,738 L356R probably damaging Het
Pard6b C T 2: 168,099,023 A310V probably benign Het
Pcgf5 C A 19: 36,437,340 N26K possibly damaging Het
Phtf1 G A 3: 104,003,603 probably null Het
Plch1 C A 3: 63,711,219 D675Y probably damaging Het
Plk2 A G 13: 110,396,337 H144R probably damaging Het
Rax T A 18: 65,935,081 N318Y unknown Het
Slc9a5 A G 8: 105,358,471 N535D possibly damaging Het
Smarcd2 T A 11: 106,266,905 K138* probably null Het
Taar7e A T 10: 24,038,034 I141F probably damaging Het
Taar7f T A 10: 24,050,023 W172R probably damaging Het
Tango6 A G 8: 106,689,224 I226V probably benign Het
Tcn2 T C 11: 3,922,114 K338E possibly damaging Het
Tdp1 C A 12: 99,898,329 A243E probably damaging Het
Tfpt A G 7: 3,620,387 Y240H probably damaging Het
Tmod4 A G 3: 95,127,829 D215G probably benign Het
Top3b A G 16: 16,882,532 probably null Het
Urgcp C A 11: 5,715,878 G820V probably damaging Het
Zfand2b A T 1: 75,169,810 M110L probably benign Het
Zfyve1 A T 12: 83,575,135 V162E probably damaging Het
Other mutations in Dpysl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01111:Dpysl2 APN 14 66834232 missense probably damaging 1.00
IGL01451:Dpysl2 APN 14 66807918 missense possibly damaging 0.64
IGL02080:Dpysl2 APN 14 66829945 missense probably benign 0.01
IGL02313:Dpysl2 APN 14 66824390 missense probably benign 0.01
IGL02530:Dpysl2 APN 14 66824398 missense probably damaging 1.00
IGL03082:Dpysl2 APN 14 66808010 missense probably damaging 1.00
IGL03357:Dpysl2 APN 14 66813287 missense probably damaging 0.97
R0491:Dpysl2 UTSW 14 66807962 missense probably damaging 1.00
R0564:Dpysl2 UTSW 14 66805446 splice site probably benign
R1121:Dpysl2 UTSW 14 66862552 missense probably benign 0.13
R1190:Dpysl2 UTSW 14 66824401 missense probably benign 0.17
R1595:Dpysl2 UTSW 14 66815503 missense probably damaging 1.00
R1786:Dpysl2 UTSW 14 66862665 splice site probably benign
R1830:Dpysl2 UTSW 14 66868391 unclassified probably benign
R2076:Dpysl2 UTSW 14 66865122 missense probably damaging 1.00
R3615:Dpysl2 UTSW 14 66834370 missense probably damaging 1.00
R3616:Dpysl2 UTSW 14 66834370 missense probably damaging 1.00
R3928:Dpysl2 UTSW 14 66824431 missense possibly damaging 0.71
R4209:Dpysl2 UTSW 14 66815477 missense probably damaging 0.98
R4793:Dpysl2 UTSW 14 66815049 missense possibly damaging 0.93
R4859:Dpysl2 UTSW 14 66829439 missense probably damaging 1.00
R5640:Dpysl2 UTSW 14 66834368 missense probably benign 0.43
R5708:Dpysl2 UTSW 14 66813146 missense probably benign 0.07
R5808:Dpysl2 UTSW 14 66865172 critical splice acceptor site probably null
R7045:Dpysl2 UTSW 14 66829946 missense probably benign 0.06
R7140:Dpysl2 UTSW 14 66862533 missense probably benign 0.00
R7211:Dpysl2 UTSW 14 66829976 missense probably damaging 0.99
R7316:Dpysl2 UTSW 14 66862595 missense possibly damaging 0.94
R7361:Dpysl2 UTSW 14 66834215 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGGAAGTCCCACCCAAGATG -3'
(R):5'- ATGCCTGCTAAGAGTGGTCTC -3'

Sequencing Primer
(F):5'- ACTTAGCGACCCTAACTTCGG -3'
(R):5'- CTTGTTCTTAGTGTGTCAGACTGAGC -3'
Posted On2015-06-10