Incidental Mutation 'R4211:Rax'
ID319222
Institutional Source Beutler Lab
Gene Symbol Rax
Ensembl Gene ENSMUSG00000024518
Gene Nameretina and anterior neural fold homeobox
Synonymsey1, Rx, E130303K03Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.552) question?
Stock #R4211 (G1)
Quality Score191
Status Not validated
Chromosome18
Chromosomal Location65934639-65939089 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 65935081 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 318 (N318Y)
Ref Sequence ENSEMBL: ENSMUSP00000025396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025396]
Predicted Effect unknown
Transcript: ENSMUST00000025396
AA Change: N318Y
SMART Domains Protein: ENSMUSP00000025396
Gene: ENSMUSG00000024518
AA Change: N318Y

DomainStartEndE-ValueType
low complexity region 128 135 N/A INTRINSIC
HOX 136 198 1.25e-27 SMART
low complexity region 207 253 N/A INTRINSIC
low complexity region 257 271 N/A INTRINSIC
low complexity region 285 297 N/A INTRINSIC
Pfam:OAR 314 334 1.4e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181100
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homeobox-containing transcription factor that functions in eye development. The gene is expressed early in the eye primordia, and is required for retinal cell fate determination and also regulates stem cell proliferation. Mutations in this gene have been reported in patients with defects in ocular development, including microphthalmia, anophthalmia, and coloboma.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous null mutants die neonatally with severe brain defects including absence of forebrain/midbrain structures and fail to form eye structures. Homozygous hypomorph mutants are viable, but lack eyes and optic tracts and have hypothalamic defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T G 5: 90,564,237 V63G probably damaging Het
Adgb T C 10: 10,407,465 I166V probably benign Het
Anapc5 T C 5: 122,817,905 E154G probably benign Het
Anpep A T 7: 79,840,996 Y257* probably null Het
Atp8b1 A T 18: 64,553,047 D688E probably damaging Het
Bub1b C A 2: 118,630,978 H670Q possibly damaging Het
Casp3 G T 8: 46,635,388 D107Y probably damaging Het
Clcc1 A T 3: 108,663,591 Y105F possibly damaging Het
Cr2 A C 1: 195,156,328 L671R probably damaging Het
Cttnbp2 A G 6: 18,427,543 V713A probably damaging Het
Cyp4a31 T C 4: 115,565,013 F65L probably benign Het
Dpysl2 T C 14: 66,815,477 S308G probably damaging Het
Dusp22 A T 13: 30,708,743 I168F probably benign Het
Ecel1 A G 1: 87,152,150 S414P probably damaging Het
Fat2 A G 11: 55,283,984 F1968L probably damaging Het
Fsip2 C T 2: 82,975,149 T604I probably damaging Het
Gatsl2 T C 5: 134,125,944 probably null Het
H2-DMb1 T A 17: 34,155,573 F66I possibly damaging Het
Hgf T C 5: 16,614,993 V574A probably damaging Het
Hoxa7 A T 6: 52,216,625 Y137* probably null Het
Ikbke T A 1: 131,263,348 I519F probably damaging Het
Inpp5j T G 11: 3,501,107 H514P probably damaging Het
Kmt2d A G 15: 98,840,189 probably benign Het
Larp7 T A 3: 127,546,954 R112S probably benign Het
Lepr C T 4: 101,733,414 A63V probably benign Het
Lmx1a G T 1: 167,832,859 V238L probably damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mcmbp T C 7: 128,716,005 E172G possibly damaging Het
Mcpt8 G A 14: 56,083,918 H30Y probably damaging Het
Nek8 C A 11: 78,170,483 V379L probably benign Het
Numa1 T G 7: 102,009,738 L356R probably damaging Het
Pard6b C T 2: 168,099,023 A310V probably benign Het
Pcgf5 C A 19: 36,437,340 N26K possibly damaging Het
Phtf1 G A 3: 104,003,603 probably null Het
Plch1 C A 3: 63,711,219 D675Y probably damaging Het
Plk2 A G 13: 110,396,337 H144R probably damaging Het
Slc9a5 A G 8: 105,358,471 N535D possibly damaging Het
Smarcd2 T A 11: 106,266,905 K138* probably null Het
Taar7e A T 10: 24,038,034 I141F probably damaging Het
Taar7f T A 10: 24,050,023 W172R probably damaging Het
Tango6 A G 8: 106,689,224 I226V probably benign Het
Tcn2 T C 11: 3,922,114 K338E possibly damaging Het
Tdp1 C A 12: 99,898,329 A243E probably damaging Het
Tfpt A G 7: 3,620,387 Y240H probably damaging Het
Tmod4 A G 3: 95,127,829 D215G probably benign Het
Top3b A G 16: 16,882,532 probably null Het
Urgcp C A 11: 5,715,878 G820V probably damaging Het
Zfand2b A T 1: 75,169,810 M110L probably benign Het
Zfyve1 A T 12: 83,575,135 V162E probably damaging Het
Other mutations in Rax
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02542:Rax APN 18 65938630 missense possibly damaging 0.68
IGL03290:Rax APN 18 65938160 missense probably damaging 1.00
R4210:Rax UTSW 18 65935081 missense unknown
R5138:Rax UTSW 18 65938318 intron probably benign
R6039:Rax UTSW 18 65935347 missense unknown
R6039:Rax UTSW 18 65935347 missense unknown
R6235:Rax UTSW 18 65935161 missense unknown
R6578:Rax UTSW 18 65938667 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCTTTCGAAGAGTAGGCGCG -3'
(R):5'- TGAAGCTGCAGGATTCTCCC -3'

Sequencing Primer
(F):5'- AGAGTAGGCGCGAGTGTCC -3'
(R):5'- CCTTCCTCGGCACTGGC -3'
Posted On2015-06-10