Incidental Mutation 'R4212:Kmt2c'
ID 319237
Institutional Source Beutler Lab
Gene Symbol Kmt2c
Ensembl Gene ENSMUSG00000038056
Gene Name lysine (K)-specific methyltransferase 2C
Synonyms Mll3, E330008K23Rik, HALR
MMRRC Submission 041641-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4212 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 25271798-25498783 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 25347359 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045291] [ENSMUST00000173073]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000045291
SMART Domains Protein: ENSMUSP00000043874
Gene: ENSMUSG00000038056

DomainStartEndE-ValueType
low complexity region 9 32 N/A INTRINSIC
AT_hook 34 46 9.68e-1 SMART
low complexity region 73 87 N/A INTRINSIC
PHD 283 330 2.56e-2 SMART
C1 329 384 5.45e-1 SMART
PHD 342 388 4.19e-7 SMART
RING 343 387 1.45e-1 SMART
PHD 389 435 4.77e-11 SMART
RING 390 434 1.46e0 SMART
PHD 465 517 8.25e-6 SMART
low complexity region 776 789 N/A INTRINSIC
AT_hook 898 910 1.41e2 SMART
PHD 953 1002 2.89e-10 SMART
RING 954 1001 4.74e0 SMART
C1 994 1045 8.38e-2 SMART
PHD 1003 1049 1.05e-12 SMART
PHD 1080 1131 2.08e-2 SMART
low complexity region 1189 1201 N/A INTRINSIC
low complexity region 1337 1348 N/A INTRINSIC
low complexity region 1394 1406 N/A INTRINSIC
low complexity region 1431 1442 N/A INTRINSIC
low complexity region 1520 1539 N/A INTRINSIC
low complexity region 1557 1570 N/A INTRINSIC
HMG 1639 1703 2.64e-3 SMART
low complexity region 1708 1724 N/A INTRINSIC
coiled coil region 1745 1789 N/A INTRINSIC
low complexity region 1847 1860 N/A INTRINSIC
low complexity region 1864 1891 N/A INTRINSIC
internal_repeat_3 1893 2084 1.27e-14 PROSPERO
internal_repeat_3 2123 2306 1.27e-14 PROSPERO
low complexity region 2336 2348 N/A INTRINSIC
low complexity region 2375 2394 N/A INTRINSIC
low complexity region 2427 2440 N/A INTRINSIC
low complexity region 2516 2527 N/A INTRINSIC
low complexity region 2696 2720 N/A INTRINSIC
low complexity region 2723 2742 N/A INTRINSIC
low complexity region 2930 2943 N/A INTRINSIC
coiled coil region 3048 3075 N/A INTRINSIC
low complexity region 3156 3165 N/A INTRINSIC
low complexity region 3173 3195 N/A INTRINSIC
coiled coil region 3226 3270 N/A INTRINSIC
low complexity region 3277 3290 N/A INTRINSIC
coiled coil region 3389 3427 N/A INTRINSIC
low complexity region 3460 3486 N/A INTRINSIC
low complexity region 3597 3611 N/A INTRINSIC
low complexity region 3649 3667 N/A INTRINSIC
low complexity region 3769 3783 N/A INTRINSIC
low complexity region 3822 3827 N/A INTRINSIC
low complexity region 3860 3869 N/A INTRINSIC
low complexity region 3887 3904 N/A INTRINSIC
low complexity region 3994 4009 N/A INTRINSIC
low complexity region 4015 4038 N/A INTRINSIC
low complexity region 4293 4309 N/A INTRINSIC
low complexity region 4412 4419 N/A INTRINSIC
PHD 4454 4500 2.94e-2 SMART
RING 4455 4499 8.1e0 SMART
FYRN 4554 4597 1.18e-21 SMART
FYRC 4603 4690 4.54e-32 SMART
SET 4764 4886 3.17e-34 SMART
PostSET 4888 4904 1.82e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000173073
SMART Domains Protein: ENSMUSP00000134442
Gene: ENSMUSG00000038056

DomainStartEndE-ValueType
low complexity region 9 32 N/A INTRINSIC
AT_hook 34 46 9.68e-1 SMART
low complexity region 73 87 N/A INTRINSIC
PHD 283 330 2.56e-2 SMART
C1 329 384 5.45e-1 SMART
PHD 342 388 4.19e-7 SMART
RING 343 387 1.45e-1 SMART
PHD 389 435 4.77e-11 SMART
RING 390 434 1.46e0 SMART
PHD 465 517 8.25e-6 SMART
low complexity region 776 789 N/A INTRINSIC
AT_hook 858 870 1.41e2 SMART
PHD 913 962 2.89e-10 SMART
RING 914 961 4.74e0 SMART
C1 954 1005 8.38e-2 SMART
PHD 963 1009 1.05e-12 SMART
PHD 1040 1091 2.08e-2 SMART
low complexity region 1149 1161 N/A INTRINSIC
low complexity region 1297 1308 N/A INTRINSIC
low complexity region 1354 1366 N/A INTRINSIC
low complexity region 1445 1464 N/A INTRINSIC
low complexity region 1482 1495 N/A INTRINSIC
HMG 1564 1628 2.64e-3 SMART
low complexity region 1633 1649 N/A INTRINSIC
coiled coil region 1670 1714 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myeloid/lymphoid or mixed-lineage leukemia (MLL) family and encodes a nuclear protein with an AT hook DNA-binding domain, a DHHC-type zinc finger, six PHD-type zinc fingers, a SET domain, a post-SET domain and a RING-type zinc finger. This protein is a member of the ASC-2/NCOA6 complex (ASCOM), which possesses histone methylation activity and is involved in transcriptional coactivation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display partial embryonic lethality, delayed eyelid opening, postnatal growth retardation, impaired fertility in both sexes, and decreased proliferation of cultured mouse embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik C T 13: 58,381,991 (GRCm38) G269E probably damaging Het
A1bg G T 15: 60,919,736 (GRCm38) L284M possibly damaging Het
Adamts15 A G 9: 30,906,174 (GRCm38) V536A probably damaging Het
AI464131 T C 4: 41,498,307 (GRCm38) E441G probably benign Het
Arsi A T 18: 60,916,701 (GRCm38) I219F probably damaging Het
Atg7 G A 6: 114,703,425 (GRCm38) G447E probably benign Het
Bdp1 T A 13: 100,059,585 (GRCm38) H1223L probably benign Het
Cep152 A G 2: 125,620,001 (GRCm38) M87T probably benign Het
Chrm3 T C 13: 9,877,755 (GRCm38) D415G probably benign Het
Chrnb2 A T 3: 89,761,544 (GRCm38) C155S probably damaging Het
Col6a4 T A 9: 106,075,370 (GRCm38) Q443L probably benign Het
D5Ertd579e A T 5: 36,614,479 (GRCm38) D857E probably damaging Het
Efcab6 T C 15: 83,892,863 (GRCm38) D1124G probably damaging Het
F830045P16Rik C T 2: 129,460,353 (GRCm38) A440T probably benign Het
Gc T C 5: 89,435,575 (GRCm38) K370E probably benign Het
Gm11559 A G 11: 99,864,900 (GRCm38) Q125R unknown Het
Gm3985 A T 8: 32,942,456 (GRCm38) noncoding transcript Het
Gm648 C T X: 56,545,208 (GRCm38) V78I probably benign Het
Gm8765 C T 13: 50,700,352 (GRCm38) T82I possibly damaging Het
Gucy2e A G 11: 69,228,123 (GRCm38) F681S probably damaging Het
Hip1r A G 5: 123,999,890 (GRCm38) I760V probably benign Het
Islr2 C T 9: 58,199,320 (GRCm38) G219D probably damaging Het
Itgae A G 11: 73,119,352 (GRCm38) H556R probably benign Het
Jag1 T C 2: 137,085,070 (GRCm38) D923G probably benign Het
Kmt2d A G 15: 98,845,003 (GRCm38) probably benign Het
Krtap17-1 A G 11: 99,993,914 (GRCm38) L9P unknown Het
Lats2 C T 14: 57,696,255 (GRCm38) D802N possibly damaging Het
Lrfn5 A T 12: 61,843,820 (GRCm38) T632S probably benign Het
Myo9a C T 9: 59,906,066 (GRCm38) R2183* probably null Het
Naip1 T C 13: 100,426,875 (GRCm38) probably null Het
Nf1 T A 11: 79,469,798 (GRCm38) V1434E probably damaging Het
Nlrc4 T C 17: 74,447,115 (GRCm38) Y91C possibly damaging Het
Olfr1454 T G 19: 13,063,759 (GRCm38) M116R probably damaging Het
Olfr173 T A 16: 58,797,369 (GRCm38) H159L possibly damaging Het
Olfr723 A T 14: 49,928,889 (GRCm38) Y218* probably null Het
Pard3 T A 8: 127,610,458 (GRCm38) I1143K probably benign Het
Pcdha7 A G 18: 36,974,974 (GRCm38) T351A probably benign Het
Phf2 C A 13: 48,820,613 (GRCm38) G318V unknown Het
Plch1 T A 3: 63,870,759 (GRCm38) probably benign Het
Polr1c A G 17: 46,246,120 (GRCm38) I79T probably damaging Het
Ppp2r5e A G 12: 75,469,551 (GRCm38) I244T probably damaging Het
Psmd12 T C 11: 107,485,759 (GRCm38) C74R probably damaging Het
Ralgapa1 A G 12: 55,739,330 (GRCm38) probably null Het
Robo3 C T 9: 37,421,898 (GRCm38) G781D probably damaging Het
Scn8a T C 15: 100,957,073 (GRCm38) V147A possibly damaging Het
Sema3b C T 9: 107,603,398 (GRCm38) V117M probably damaging Het
Sfxn5 A T 6: 85,332,306 (GRCm38) L139* probably null Het
Slc2a12 A T 10: 22,702,094 (GRCm38) K596N probably benign Het
Sorcs1 G A 19: 50,225,175 (GRCm38) R705C probably damaging Het
Tlr4 T A 4: 66,840,326 (GRCm38) I452N probably damaging Het
Tshz3 A G 7: 36,770,119 (GRCm38) D511G probably damaging Het
Usp44 A G 10: 93,846,770 (GRCm38) K314E possibly damaging Het
Other mutations in Kmt2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Kmt2c APN 5 25,281,261 (GRCm38) missense probably damaging 0.99
IGL00694:Kmt2c APN 5 25,293,161 (GRCm38) missense probably damaging 0.99
IGL00780:Kmt2c APN 5 25,311,051 (GRCm38) missense probably benign 0.00
IGL00811:Kmt2c APN 5 25,374,533 (GRCm38) missense possibly damaging 0.75
IGL00885:Kmt2c APN 5 25,409,171 (GRCm38) missense possibly damaging 0.80
IGL00948:Kmt2c APN 5 25,377,161 (GRCm38) missense probably benign 0.08
IGL00959:Kmt2c APN 5 25,276,229 (GRCm38) missense probably damaging 1.00
IGL01022:Kmt2c APN 5 25,302,701 (GRCm38) unclassified probably benign
IGL01146:Kmt2c APN 5 25,308,512 (GRCm38) missense probably damaging 0.96
IGL01154:Kmt2c APN 5 25,284,399 (GRCm38) missense probably damaging 1.00
IGL01434:Kmt2c APN 5 25,409,308 (GRCm38) missense probably damaging 1.00
IGL01464:Kmt2c APN 5 25,352,244 (GRCm38) missense possibly damaging 0.90
IGL01525:Kmt2c APN 5 25,329,441 (GRCm38) splice site probably benign
IGL01530:Kmt2c APN 5 25,313,500 (GRCm38) missense probably benign 0.08
IGL01550:Kmt2c APN 5 25,281,276 (GRCm38) missense probably damaging 1.00
IGL01598:Kmt2c APN 5 25,273,666 (GRCm38) makesense probably null
IGL01598:Kmt2c APN 5 25,354,771 (GRCm38) missense probably damaging 1.00
IGL01608:Kmt2c APN 5 25,354,811 (GRCm38) missense probably damaging 0.97
IGL01663:Kmt2c APN 5 25,310,670 (GRCm38) missense probably damaging 1.00
IGL01707:Kmt2c APN 5 25,300,098 (GRCm38) missense probably damaging 1.00
IGL01714:Kmt2c APN 5 25,313,400 (GRCm38) missense probably benign
IGL01784:Kmt2c APN 5 25,313,526 (GRCm38) missense probably damaging 1.00
IGL01813:Kmt2c APN 5 25,290,804 (GRCm38) missense possibly damaging 0.82
IGL01825:Kmt2c APN 5 25,310,596 (GRCm38) missense probably damaging 1.00
IGL01834:Kmt2c APN 5 25,395,455 (GRCm38) missense probably benign 0.05
IGL02072:Kmt2c APN 5 25,405,432 (GRCm38) missense possibly damaging 0.96
IGL02159:Kmt2c APN 5 25,311,343 (GRCm38) missense probably benign 0.18
IGL02303:Kmt2c APN 5 25,310,157 (GRCm38) missense probably damaging 0.96
IGL02417:Kmt2c APN 5 25,373,020 (GRCm38) missense probably benign
IGL02578:Kmt2c APN 5 25,366,200 (GRCm38) intron probably benign
IGL02811:Kmt2c APN 5 25,315,028 (GRCm38) nonsense probably null
IGL02943:Kmt2c APN 5 25,290,823 (GRCm38) missense probably damaging 1.00
IGL03000:Kmt2c APN 5 25,284,172 (GRCm38) missense probably damaging 1.00
IGL03040:Kmt2c APN 5 25,310,352 (GRCm38) missense probably benign
IGL03076:Kmt2c APN 5 25,299,151 (GRCm38) nonsense probably null
IGL03088:Kmt2c APN 5 25,299,804 (GRCm38) missense probably damaging 0.99
IGL03131:Kmt2c APN 5 25,315,361 (GRCm38) missense probably benign 0.00
FR4304:Kmt2c UTSW 5 25,315,766 (GRCm38) small insertion probably benign
FR4976:Kmt2c UTSW 5 25,315,763 (GRCm38) small insertion probably benign
PIT4520001:Kmt2c UTSW 5 25,315,666 (GRCm38) missense probably benign 0.12
PIT4585001:Kmt2c UTSW 5 25,315,106 (GRCm38) missense probably benign 0.21
R0313:Kmt2c UTSW 5 25,344,930 (GRCm38) missense probably damaging 1.00
R0374:Kmt2c UTSW 5 25,309,708 (GRCm38) missense probably damaging 1.00
R0411:Kmt2c UTSW 5 25,375,957 (GRCm38) missense probably damaging 1.00
R0422:Kmt2c UTSW 5 25,315,664 (GRCm38) missense probably benign
R0453:Kmt2c UTSW 5 25,354,747 (GRCm38) missense probably damaging 1.00
R0616:Kmt2c UTSW 5 25,299,252 (GRCm38) missense probably benign
R0619:Kmt2c UTSW 5 25,298,916 (GRCm38) missense probably benign 0.21
R0671:Kmt2c UTSW 5 25,404,365 (GRCm38) missense probably damaging 1.00
R0736:Kmt2c UTSW 5 25,295,434 (GRCm38) missense probably benign
R0745:Kmt2c UTSW 5 25,359,698 (GRCm38) splice site probably null
R0760:Kmt2c UTSW 5 25,353,317 (GRCm38) missense possibly damaging 0.68
R0784:Kmt2c UTSW 5 25,310,895 (GRCm38) missense probably benign 0.00
R0882:Kmt2c UTSW 5 25,295,607 (GRCm38) missense possibly damaging 0.90
R0893:Kmt2c UTSW 5 25,351,270 (GRCm38) splice site probably benign
R0942:Kmt2c UTSW 5 25,315,303 (GRCm38) missense probably benign 0.10
R1110:Kmt2c UTSW 5 25,314,362 (GRCm38) missense probably benign 0.01
R1137:Kmt2c UTSW 5 25,310,983 (GRCm38) missense possibly damaging 0.80
R1255:Kmt2c UTSW 5 25,351,153 (GRCm38) missense probably damaging 1.00
R1300:Kmt2c UTSW 5 25,405,454 (GRCm38) missense probably damaging 0.99
R1497:Kmt2c UTSW 5 25,314,515 (GRCm38) missense possibly damaging 0.80
R1594:Kmt2c UTSW 5 25,314,878 (GRCm38) missense probably benign 0.01
R1611:Kmt2c UTSW 5 25,359,311 (GRCm38) critical splice donor site probably null
R1617:Kmt2c UTSW 5 25,375,927 (GRCm38) missense probably benign 0.01
R1720:Kmt2c UTSW 5 25,299,184 (GRCm38) missense probably benign 0.05
R1723:Kmt2c UTSW 5 25,315,005 (GRCm38) missense probably damaging 1.00
R1724:Kmt2c UTSW 5 25,315,005 (GRCm38) missense probably damaging 1.00
R1726:Kmt2c UTSW 5 25,315,005 (GRCm38) missense probably damaging 1.00
R1736:Kmt2c UTSW 5 25,290,527 (GRCm38) missense probably damaging 1.00
R1778:Kmt2c UTSW 5 25,372,974 (GRCm38) missense probably benign 0.02
R1809:Kmt2c UTSW 5 25,284,192 (GRCm38) missense probably damaging 1.00
R1845:Kmt2c UTSW 5 25,373,436 (GRCm38) missense probably benign 0.45
R1895:Kmt2c UTSW 5 25,315,154 (GRCm38) missense probably benign 0.34
R1946:Kmt2c UTSW 5 25,315,154 (GRCm38) missense probably benign 0.34
R1989:Kmt2c UTSW 5 25,498,544 (GRCm38) missense possibly damaging 0.93
R2039:Kmt2c UTSW 5 25,329,040 (GRCm38) missense possibly damaging 0.53
R2049:Kmt2c UTSW 5 25,285,079 (GRCm38) missense probably damaging 1.00
R2079:Kmt2c UTSW 5 25,352,280 (GRCm38) missense possibly damaging 0.82
R2080:Kmt2c UTSW 5 25,354,717 (GRCm38) missense probably damaging 1.00
R2107:Kmt2c UTSW 5 25,309,824 (GRCm38) missense probably benign 0.01
R2186:Kmt2c UTSW 5 25,287,112 (GRCm38) missense probably damaging 1.00
R2395:Kmt2c UTSW 5 25,315,152 (GRCm38) missense probably benign
R2983:Kmt2c UTSW 5 25,315,757 (GRCm38) small deletion probably benign
R3109:Kmt2c UTSW 5 25,275,735 (GRCm38) missense probably damaging 1.00
R3500:Kmt2c UTSW 5 25,299,479 (GRCm38) missense probably benign 0.02
R3738:Kmt2c UTSW 5 25,405,383 (GRCm38) missense probably benign 0.41
R3809:Kmt2c UTSW 5 25,409,138 (GRCm38) missense possibly damaging 0.87
R4088:Kmt2c UTSW 5 25,287,713 (GRCm38) missense probably benign
R4107:Kmt2c UTSW 5 25,298,920 (GRCm38) missense possibly damaging 0.51
R4376:Kmt2c UTSW 5 25,315,326 (GRCm38) missense probably benign 0.00
R4377:Kmt2c UTSW 5 25,315,326 (GRCm38) missense probably benign 0.00
R4383:Kmt2c UTSW 5 25,351,062 (GRCm38) missense possibly damaging 0.77
R4435:Kmt2c UTSW 5 25,314,877 (GRCm38) missense possibly damaging 0.63
R4456:Kmt2c UTSW 5 25,310,212 (GRCm38) missense probably benign
R4461:Kmt2c UTSW 5 25,299,876 (GRCm38) missense probably benign 0.00
R4519:Kmt2c UTSW 5 25,363,477 (GRCm38) missense probably damaging 1.00
R4550:Kmt2c UTSW 5 25,300,174 (GRCm38) missense probably damaging 1.00
R4557:Kmt2c UTSW 5 25,300,315 (GRCm38) missense probably damaging 1.00
R4610:Kmt2c UTSW 5 25,354,384 (GRCm38) missense probably damaging 1.00
R4671:Kmt2c UTSW 5 25,366,177 (GRCm38) missense probably damaging 1.00
R4704:Kmt2c UTSW 5 25,314,027 (GRCm38) nonsense probably null
R4781:Kmt2c UTSW 5 25,443,825 (GRCm38) missense probably damaging 1.00
R4844:Kmt2c UTSW 5 25,315,113 (GRCm38) missense probably benign
R4855:Kmt2c UTSW 5 25,314,557 (GRCm38) missense probably benign 0.00
R4919:Kmt2c UTSW 5 25,314,395 (GRCm38) missense possibly damaging 0.80
R4971:Kmt2c UTSW 5 25,310,872 (GRCm38) missense probably benign 0.00
R4983:Kmt2c UTSW 5 25,295,511 (GRCm38) missense possibly damaging 0.51
R5012:Kmt2c UTSW 5 25,299,712 (GRCm38) nonsense probably null
R5033:Kmt2c UTSW 5 25,314,708 (GRCm38) missense probably benign 0.03
R5093:Kmt2c UTSW 5 25,409,207 (GRCm38) missense probably benign 0.17
R5125:Kmt2c UTSW 5 25,284,381 (GRCm38) missense probably damaging 0.99
R5231:Kmt2c UTSW 5 25,315,473 (GRCm38) missense possibly damaging 0.89
R5254:Kmt2c UTSW 5 25,314,594 (GRCm38) missense probably benign 0.01
R5396:Kmt2c UTSW 5 25,294,734 (GRCm38) splice site probably null
R5415:Kmt2c UTSW 5 25,314,701 (GRCm38) missense probably benign 0.21
R5523:Kmt2c UTSW 5 25,299,339 (GRCm38) missense probably benign 0.00
R5554:Kmt2c UTSW 5 25,294,610 (GRCm38) missense probably damaging 1.00
R5701:Kmt2c UTSW 5 25,314,017 (GRCm38) missense probably benign 0.16
R5762:Kmt2c UTSW 5 25,310,457 (GRCm38) missense probably benign 0.01
R5819:Kmt2c UTSW 5 25,409,132 (GRCm38) critical splice donor site probably null
R5838:Kmt2c UTSW 5 25,284,471 (GRCm38) missense probably damaging 1.00
R5912:Kmt2c UTSW 5 25,347,469 (GRCm38) missense possibly damaging 0.80
R5951:Kmt2c UTSW 5 25,330,803 (GRCm38) missense probably benign 0.15
R5988:Kmt2c UTSW 5 25,311,120 (GRCm38) missense probably benign 0.02
R5999:Kmt2c UTSW 5 25,284,205 (GRCm38) missense probably damaging 1.00
R6104:Kmt2c UTSW 5 25,299,129 (GRCm38) missense probably benign
R6254:Kmt2c UTSW 5 25,349,874 (GRCm38) missense possibly damaging 0.94
R6311:Kmt2c UTSW 5 25,443,818 (GRCm38) critical splice donor site probably null
R6329:Kmt2c UTSW 5 25,315,602 (GRCm38) missense probably benign 0.01
R6347:Kmt2c UTSW 5 25,310,835 (GRCm38) missense possibly damaging 0.54
R6364:Kmt2c UTSW 5 25,309,636 (GRCm38) missense probably null 0.99
R6379:Kmt2c UTSW 5 25,359,341 (GRCm38) missense probably damaging 1.00
R6588:Kmt2c UTSW 5 25,323,789 (GRCm38) missense probably damaging 0.99
R6628:Kmt2c UTSW 5 25,298,928 (GRCm38) missense probably benign
R6733:Kmt2c UTSW 5 25,409,293 (GRCm38) missense probably damaging 1.00
R6787:Kmt2c UTSW 5 25,275,739 (GRCm38) splice site probably null
R6816:Kmt2c UTSW 5 25,405,532 (GRCm38) splice site probably null
R6862:Kmt2c UTSW 5 25,310,517 (GRCm38) missense probably damaging 1.00
R7150:Kmt2c UTSW 5 25,300,362 (GRCm38) missense possibly damaging 0.89
R7220:Kmt2c UTSW 5 25,344,925 (GRCm38) missense probably damaging 1.00
R7250:Kmt2c UTSW 5 25,309,807 (GRCm38) missense probably benign 0.00
R7250:Kmt2c UTSW 5 25,299,491 (GRCm38) missense probably damaging 1.00
R7402:Kmt2c UTSW 5 25,395,420 (GRCm38) missense probably damaging 1.00
R7465:Kmt2c UTSW 5 25,302,849 (GRCm38) missense probably damaging 1.00
R7467:Kmt2c UTSW 5 25,308,532 (GRCm38) missense probably damaging 1.00
R7491:Kmt2c UTSW 5 25,284,564 (GRCm38) missense probably damaging 0.99
R7549:Kmt2c UTSW 5 25,414,970 (GRCm38) missense possibly damaging 0.95
R7637:Kmt2c UTSW 5 25,315,095 (GRCm38) missense probably damaging 1.00
R7652:Kmt2c UTSW 5 25,315,719 (GRCm38) missense probably benign 0.01
R7714:Kmt2c UTSW 5 25,375,366 (GRCm38) missense probably benign
R7838:Kmt2c UTSW 5 25,294,699 (GRCm38) missense possibly damaging 0.57
R7891:Kmt2c UTSW 5 25,300,111 (GRCm38) missense probably damaging 1.00
R7892:Kmt2c UTSW 5 25,299,816 (GRCm38) missense probably benign 0.18
R7895:Kmt2c UTSW 5 25,373,176 (GRCm38) missense possibly damaging 0.65
R7960:Kmt2c UTSW 5 25,315,196 (GRCm38) missense probably benign 0.01
R7974:Kmt2c UTSW 5 25,300,563 (GRCm38) missense probably damaging 1.00
R7978:Kmt2c UTSW 5 25,359,678 (GRCm38) missense probably benign 0.00
R8011:Kmt2c UTSW 5 25,351,234 (GRCm38) missense probably damaging 0.99
R8021:Kmt2c UTSW 5 25,287,119 (GRCm38) missense possibly damaging 0.88
R8022:Kmt2c UTSW 5 25,281,680 (GRCm38) missense possibly damaging 0.83
R8079:Kmt2c UTSW 5 25,302,732 (GRCm38) missense probably damaging 0.98
R8087:Kmt2c UTSW 5 25,329,252 (GRCm38) missense probably damaging 1.00
R8109:Kmt2c UTSW 5 25,281,384 (GRCm38) missense probably damaging 1.00
R8161:Kmt2c UTSW 5 25,374,564 (GRCm38) missense probably benign 0.00
R8169:Kmt2c UTSW 5 25,354,687 (GRCm38) missense probably damaging 1.00
R8206:Kmt2c UTSW 5 25,314,539 (GRCm38) missense probably damaging 0.98
R8218:Kmt2c UTSW 5 25,283,106 (GRCm38) missense probably damaging 1.00
R8223:Kmt2c UTSW 5 25,324,218 (GRCm38) missense possibly damaging 0.89
R8260:Kmt2c UTSW 5 25,405,516 (GRCm38) missense possibly damaging 0.87
R8330:Kmt2c UTSW 5 25,304,694 (GRCm38) missense probably null 1.00
R8355:Kmt2c UTSW 5 25,354,501 (GRCm38) critical splice acceptor site probably null
R8455:Kmt2c UTSW 5 25,354,501 (GRCm38) critical splice acceptor site probably null
R8508:Kmt2c UTSW 5 25,314,122 (GRCm38) missense probably benign 0.34
R8885:Kmt2c UTSW 5 25,315,079 (GRCm38) missense probably benign 0.34
R8907:Kmt2c UTSW 5 25,309,611 (GRCm38) missense probably damaging 1.00
R8924:Kmt2c UTSW 5 25,298,887 (GRCm38) missense probably benign
R8969:Kmt2c UTSW 5 25,314,389 (GRCm38) missense possibly damaging 0.82
R9019:Kmt2c UTSW 5 25,283,210 (GRCm38) missense probably damaging 1.00
R9035:Kmt2c UTSW 5 25,319,012 (GRCm38) missense probably damaging 1.00
R9074:Kmt2c UTSW 5 25,284,345 (GRCm38) missense probably damaging 1.00
R9125:Kmt2c UTSW 5 25,284,196 (GRCm38) missense possibly damaging 0.86
R9130:Kmt2c UTSW 5 25,311,104 (GRCm38) missense probably benign 0.01
R9171:Kmt2c UTSW 5 25,281,311 (GRCm38) missense probably damaging 1.00
R9235:Kmt2c UTSW 5 25,299,999 (GRCm38) missense probably damaging 1.00
R9288:Kmt2c UTSW 5 25,349,862 (GRCm38) missense probably benign 0.34
R9288:Kmt2c UTSW 5 25,292,909 (GRCm38) missense probably damaging 1.00
R9336:Kmt2c UTSW 5 25,409,167 (GRCm38) missense probably benign 0.06
R9443:Kmt2c UTSW 5 25,310,047 (GRCm38) missense probably damaging 1.00
R9481:Kmt2c UTSW 5 25,292,909 (GRCm38) missense probably damaging 1.00
R9481:Kmt2c UTSW 5 25,349,862 (GRCm38) missense probably benign 0.34
R9526:Kmt2c UTSW 5 25,281,357 (GRCm38) missense probably damaging 1.00
R9653:Kmt2c UTSW 5 25,302,821 (GRCm38) missense probably damaging 1.00
R9729:Kmt2c UTSW 5 25,284,760 (GRCm38) missense probably damaging 1.00
R9731:Kmt2c UTSW 5 25,372,958 (GRCm38) missense probably benign 0.18
R9784:Kmt2c UTSW 5 25,344,961 (GRCm38) missense probably damaging 1.00
RF001:Kmt2c UTSW 5 25,315,775 (GRCm38) small insertion probably benign
RF006:Kmt2c UTSW 5 25,315,772 (GRCm38) small insertion probably benign
RF011:Kmt2c UTSW 5 25,338,459 (GRCm38) missense probably damaging 1.00
RF041:Kmt2c UTSW 5 25,315,775 (GRCm38) small insertion probably benign
RF047:Kmt2c UTSW 5 25,315,760 (GRCm38) small insertion probably benign
RF051:Kmt2c UTSW 5 25,313,479 (GRCm38) unclassified probably benign
RF055:Kmt2c UTSW 5 25,315,772 (GRCm38) small insertion probably benign
RF059:Kmt2c UTSW 5 25,313,479 (GRCm38) unclassified probably benign
RF063:Kmt2c UTSW 5 25,315,764 (GRCm38) small insertion probably benign
X0024:Kmt2c UTSW 5 25,405,485 (GRCm38) missense probably benign 0.26
X0027:Kmt2c UTSW 5 25,330,887 (GRCm38) missense possibly damaging 0.90
Z1176:Kmt2c UTSW 5 25,354,413 (GRCm38) missense probably damaging 1.00
Z1177:Kmt2c UTSW 5 25,366,197 (GRCm38) critical splice acceptor site probably null
Z1177:Kmt2c UTSW 5 25,300,003 (GRCm38) missense probably benign 0.00
Z1177:Kmt2c UTSW 5 25,295,397 (GRCm38) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGTAGGGAAATCGCCACGAG -3'
(R):5'- GACTCAGACCTGCATACATATACTC -3'

Sequencing Primer
(F):5'- AAAAGACCAGACTCTATCTTTTCCTC -3'
(R):5'- CCTGCATACATATACTCATACACATG -3'
Posted On 2015-06-10