Incidental Mutation 'R4212:Gc'
ID319239
Institutional Source Beutler Lab
Gene Symbol Gc
Ensembl Gene ENSMUSG00000035540
Gene Namevitamin D binding protein
SynonymsDBP, vitamin D binding protein
MMRRC Submission 041641-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4212 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location89417522-89457898 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89435575 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 370 (K370E)
Ref Sequence ENSEMBL: ENSMUSP00000046636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049209]
Predicted Effect probably benign
Transcript: ENSMUST00000049209
AA Change: K370E

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000046636
Gene: ENSMUSG00000035540
AA Change: K370E

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
ALBUMIN 17 202 6.82e-68 SMART
ALBUMIN 208 388 1.51e-51 SMART
Pfam:VitD-bind_III 405 469 7.2e-36 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000200534
AA Change: K18E
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the albumin gene family. It is a multifunctional protein found in plasma, ascitic fluid, cerebrospinal fluid and on the surface of many cell types. It binds to vitamin D and its plasma metabolites and transports them to target tissues. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for disruption of this gene show an essentially normal phenotype. However, they have an increased sensitivity to vitamin D deficiency in the diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik C T 13: 58,381,991 G269E probably damaging Het
A1bg G T 15: 60,919,736 L284M possibly damaging Het
Adamts15 A G 9: 30,906,174 V536A probably damaging Het
AI464131 T C 4: 41,498,307 E441G probably benign Het
Arsi A T 18: 60,916,701 I219F probably damaging Het
Atg7 G A 6: 114,703,425 G447E probably benign Het
Bdp1 T A 13: 100,059,585 H1223L probably benign Het
Cep152 A G 2: 125,620,001 M87T probably benign Het
Chrm3 T C 13: 9,877,755 D415G probably benign Het
Chrnb2 A T 3: 89,761,544 C155S probably damaging Het
Col6a4 T A 9: 106,075,370 Q443L probably benign Het
D5Ertd579e A T 5: 36,614,479 D857E probably damaging Het
Efcab6 T C 15: 83,892,863 D1124G probably damaging Het
F830045P16Rik C T 2: 129,460,353 A440T probably benign Het
Gm11559 A G 11: 99,864,900 Q125R unknown Het
Gm3985 A T 8: 32,942,456 noncoding transcript Het
Gm648 C T X: 56,545,208 V78I probably benign Het
Gm8765 C T 13: 50,700,352 T82I possibly damaging Het
Gucy2e A G 11: 69,228,123 F681S probably damaging Het
Hip1r A G 5: 123,999,890 I760V probably benign Het
Islr2 C T 9: 58,199,320 G219D probably damaging Het
Itgae A G 11: 73,119,352 H556R probably benign Het
Jag1 T C 2: 137,085,070 D923G probably benign Het
Kmt2c A G 5: 25,347,359 probably null Het
Kmt2d A G 15: 98,845,003 probably benign Het
Krtap17-1 A G 11: 99,993,914 L9P unknown Het
Lats2 C T 14: 57,696,255 D802N possibly damaging Het
Lrfn5 A T 12: 61,843,820 T632S probably benign Het
Myo9a C T 9: 59,906,066 R2183* probably null Het
Naip1 T C 13: 100,426,875 probably null Het
Nf1 T A 11: 79,469,798 V1434E probably damaging Het
Nlrc4 T C 17: 74,447,115 Y91C possibly damaging Het
Olfr1454 T G 19: 13,063,759 M116R probably damaging Het
Olfr173 T A 16: 58,797,369 H159L possibly damaging Het
Olfr723 A T 14: 49,928,889 Y218* probably null Het
Pard3 T A 8: 127,610,458 I1143K probably benign Het
Pcdha7 A G 18: 36,974,974 T351A probably benign Het
Phf2 C A 13: 48,820,613 G318V unknown Het
Plch1 T A 3: 63,870,759 probably benign Het
Polr1c A G 17: 46,246,120 I79T probably damaging Het
Ppp2r5e A G 12: 75,469,551 I244T probably damaging Het
Psmd12 T C 11: 107,485,759 C74R probably damaging Het
Ralgapa1 A G 12: 55,739,330 probably null Het
Robo3 C T 9: 37,421,898 G781D probably damaging Het
Scn8a T C 15: 100,957,073 V147A possibly damaging Het
Sema3b C T 9: 107,603,398 V117M probably damaging Het
Sfxn5 A T 6: 85,332,306 L139* probably null Het
Slc2a12 A T 10: 22,702,094 K596N probably benign Het
Sorcs1 G A 19: 50,225,175 R705C probably damaging Het
Tlr4 T A 4: 66,840,326 I452N probably damaging Het
Tshz3 A G 7: 36,770,119 D511G probably damaging Het
Usp44 A G 10: 93,846,770 K314E possibly damaging Het
Other mutations in Gc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01963:Gc APN 5 89422122 splice site probably benign
IGL02408:Gc APN 5 89445396 missense probably benign
IGL02815:Gc APN 5 89457659 critical splice donor site probably null
R1689:Gc UTSW 5 89441200 critical splice donor site probably null
R2067:Gc UTSW 5 89446517 missense probably damaging 1.00
R2086:Gc UTSW 5 89438342 missense probably damaging 1.00
R4459:Gc UTSW 5 89441287 missense probably benign 0.00
R4930:Gc UTSW 5 89439589 missense probably benign 0.00
R5598:Gc UTSW 5 89438450 critical splice acceptor site probably null
R5768:Gc UTSW 5 89441266 missense probably damaging 1.00
R6194:Gc UTSW 5 89441579 missense probably benign 0.27
R6748:Gc UTSW 5 89435572 missense probably benign 0.00
R8376:Gc UTSW 5 89438259 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TACGACCCTATGCAAGGTATCAAC -3'
(R):5'- TGTCATTCTGCCTTTGTAGACCAG -3'

Sequencing Primer
(F):5'- ACATATATCCTGCTCTGCACAGTAG -3'
(R):5'- TGTAGACCAGAAACAAAGTATCATTC -3'
Posted On2015-06-10