Incidental Mutation 'R0395:Col16a1'
ID31924
Institutional Source Beutler Lab
Gene Symbol Col16a1
Ensembl Gene ENSMUSG00000040690
Gene Namecollagen, type XVI, alpha 1
Synonyms2700007F12Rik, [a]1 (XVI) collagen, A530052M23Rik
MMRRC Submission 038601-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R0395 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location130047840-130099283 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 130073109 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 583 (G583D)
Ref Sequence ENSEMBL: ENSMUSP00000120339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044565] [ENSMUST00000143432] [ENSMUST00000143577]
Predicted Effect unknown
Transcript: ENSMUST00000044565
AA Change: G898D
SMART Domains Protein: ENSMUSP00000035802
Gene: ENSMUSG00000040690
AA Change: G898D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSPN 50 231 1.07e-68 SMART
internal_repeat_4 330 355 2.35e-7 PROSPERO
Pfam:Collagen 372 431 1.6e-8 PFAM
low complexity region 441 507 N/A INTRINSIC
low complexity region 525 542 N/A INTRINSIC
internal_repeat_2 546 562 2.68e-9 PROSPERO
internal_repeat_1 547 580 9.92e-10 PROSPERO
Pfam:Collagen 584 646 1.5e-9 PFAM
internal_repeat_5 662 689 6.35e-7 PROSPERO
internal_repeat_3 662 731 1.96e-8 PROSPERO
internal_repeat_7 679 695 2.06e-5 PROSPERO
internal_repeat_6 682 730 7.63e-6 PROSPERO
internal_repeat_1 685 742 9.92e-10 PROSPERO
Pfam:Collagen 796 850 3.4e-9 PFAM
internal_repeat_5 859 889 6.35e-7 PROSPERO
low complexity region 891 922 N/A INTRINSIC
low complexity region 990 1000 N/A INTRINSIC
Pfam:Collagen 1001 1064 1.4e-10 PFAM
low complexity region 1090 1112 N/A INTRINSIC
internal_repeat_7 1114 1130 2.06e-5 PROSPERO
low complexity region 1132 1162 N/A INTRINSIC
low complexity region 1171 1222 N/A INTRINSIC
low complexity region 1230 1282 N/A INTRINSIC
internal_repeat_2 1283 1299 2.68e-9 PROSPERO
internal_repeat_6 1287 1335 7.63e-6 PROSPERO
Pfam:Collagen 1350 1411 1.8e-9 PFAM
Pfam:Collagen 1446 1503 5.3e-10 PFAM
low complexity region 1505 1525 N/A INTRINSIC
low complexity region 1528 1549 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000097867
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106001
Predicted Effect probably benign
Transcript: ENSMUST00000143432
SMART Domains Protein: ENSMUSP00000120384
Gene: ENSMUSG00000040690

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSPN 50 231 1.07e-68 SMART
internal_repeat_1 330 353 5.41e-8 PROSPERO
Pfam:Collagen 372 426 2.1e-9 PFAM
low complexity region 441 507 N/A INTRINSIC
low complexity region 525 542 N/A INTRINSIC
internal_repeat_1 546 569 5.41e-8 PROSPERO
internal_repeat_2 547 580 5.41e-8 PROSPERO
Pfam:Collagen 584 646 2.7e-10 PFAM
Pfam:Collagen 659 736 8.6e-8 PFAM
Pfam:Collagen 745 797 1.6e-7 PFAM
Pfam:Collagen 796 850 5.9e-10 PFAM
Pfam:Collagen 848 923 1.6e-7 PFAM
low complexity region 974 984 N/A INTRINSIC
Pfam:Collagen 987 1045 1e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000143577
AA Change: G583D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120339
Gene: ENSMUSG00000040690
AA Change: G583D

DomainStartEndE-ValueType
internal_repeat_7 1 43 5.7e-5 PROSPERO
Pfam:Collagen 57 112 2e-9 PFAM
low complexity region 126 192 N/A INTRINSIC
low complexity region 210 227 N/A INTRINSIC
internal_repeat_2 231 247 1.5e-10 PROSPERO
internal_repeat_1 232 265 5.16e-11 PROSPERO
Pfam:Collagen 269 331 3.4e-10 PFAM
Pfam:Collagen 360 421 7e-11 PFAM
Pfam:Collagen 430 482 1.9e-7 PFAM
Pfam:Collagen 481 535 7.8e-10 PFAM
Pfam:Collagen 560 623 1.4e-7 PFAM
internal_repeat_9 640 665 9.73e-5 PROSPERO
low complexity region 675 685 N/A INTRINSIC
Pfam:Collagen 686 747 2.5e-11 PFAM
Pfam:Collagen 730 802 5.2e-9 PFAM
Pfam:Collagen 783 860 9.2e-9 PFAM
low complexity region 871 922 N/A INTRINSIC
low complexity region 930 985 N/A INTRINSIC
internal_repeat_2 986 1002 1.5e-10 PROSPERO
internal_repeat_5 990 1038 7.88e-7 PROSPERO
low complexity region 1041 1110 N/A INTRINSIC
Pfam:Collagen 1149 1205 1.8e-10 PFAM
Pfam:Collagen 1203 1260 1.1e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146606
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151541
Meta Mutation Damage Score 0.8771 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency 98% (103/105)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XVI collagen, a member of the FACIT collagen family (fibril-associated collagens with interrupted helices). Members of this collagen family are found in association with fibril-forming collagens such as type I and II, and serve to maintain the integrity of the extracellular matrix. High levels of type XVI collagen have been found in fibroblasts and keratinocytes, and in smooth muscle and amnion. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik T C 13: 59,689,656 K205R possibly damaging Het
9630041A04Rik A T 9: 101,942,735 N118I probably damaging Het
Acsm2 G A 7: 119,575,746 D245N probably damaging Het
Adgrv1 A T 13: 81,385,953 H5836Q probably benign Het
Ahcyl2 T C 6: 29,886,168 V391A probably damaging Het
Alcam A T 16: 52,309,864 M41K probably benign Het
Aldh3b3 A C 19: 3,966,472 E363D probably benign Het
Alk A G 17: 72,603,531 V60A probably damaging Het
Als2cl G A 9: 110,898,084 R906H probably damaging Het
Ap5z1 T C 5: 142,470,562 probably benign Het
Apba2 T A 7: 64,743,408 I547N probably benign Het
Apol10b A T 15: 77,585,640 D112E probably damaging Het
Ash1l C A 3: 89,058,589 R2433S probably damaging Het
Cachd1 T C 4: 100,953,205 F335L probably damaging Het
Cbfa2t3 G T 8: 122,638,951 Q181K probably benign Het
Cct6b A G 11: 82,739,680 M265T probably benign Het
Cd151 G A 7: 141,470,391 V180I probably damaging Het
Ces1h T A 8: 93,357,078 N412I unknown Het
Chmp7 T C 14: 69,732,456 T12A probably benign Het
Clasp1 A G 1: 118,539,331 T534A possibly damaging Het
Cldn15 T A 5: 136,968,198 V31E possibly damaging Het
Csmd1 T C 8: 16,346,638 N426S probably damaging Het
Dapp1 C T 3: 137,935,637 C199Y possibly damaging Het
Dchs1 A G 7: 105,758,538 L2029P probably damaging Het
Diexf T C 1: 193,123,676 E187G possibly damaging Het
Dmc1 A G 15: 79,588,772 F158S probably damaging Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
Dthd1 T A 5: 62,814,333 N166K possibly damaging Het
Enam A T 5: 88,501,508 Y292F probably damaging Het
Esrrg A T 1: 188,198,635 I285F probably damaging Het
Fam19a2 A T 10: 123,593,592 H37L probably benign Het
Fam50b A G 13: 34,747,237 D232G probably damaging Het
Fam91a1 T A 15: 58,454,792 S792T probably benign Het
Fbxw22 A C 9: 109,381,685 C419W probably damaging Het
Flt4 G A 11: 49,630,343 S393N probably benign Het
Fras1 A T 5: 96,769,653 T3511S possibly damaging Het
Frat2 A C 19: 41,847,824 S30A probably damaging Het
Glp1r T A 17: 30,936,338 M433K probably benign Het
Gm10300 G A 4: 132,074,988 probably benign Het
Gm13178 A G 4: 144,703,195 V408A probably benign Het
Gm684 C T 9: 51,280,534 probably benign Het
Gpatch4 A G 3: 88,054,354 probably benign Het
Gpr22 A T 12: 31,709,462 S220R possibly damaging Het
Grn T C 11: 102,436,223 V549A probably benign Het
Gtf3c5 T C 2: 28,577,918 D177G probably damaging Het
Htr1b A T 9: 81,631,651 M301K probably benign Het
Ifi207 A T 1: 173,729,865 S436T possibly damaging Het
Ifnb1 A T 4: 88,522,529 N82K possibly damaging Het
Ina T G 19: 47,021,919 N384K probably damaging Het
Kirrel2 T C 7: 30,450,458 N541D possibly damaging Het
Lrp2 A T 2: 69,433,077 I4377N possibly damaging Het
Lrrc37a A G 11: 103,464,395 V2532A unknown Het
Mast4 T C 13: 102,735,273 E2529G probably damaging Het
Myh6 T C 14: 54,946,320 H1719R possibly damaging Het
Myo5a A T 9: 75,193,977 H150L probably benign Het
Naglu C T 11: 101,074,107 probably benign Het
Nags G A 11: 102,145,704 A40T unknown Het
Nav1 G T 1: 135,532,621 Y321* probably null Het
Nav1 A T 1: 135,532,623 Y321N probably damaging Het
Neu3 C T 7: 99,813,778 S246N probably benign Het
Npy5r C T 8: 66,681,973 G56D probably benign Het
Nrxn1 A G 17: 91,088,314 V138A possibly damaging Het
Nuggc C T 14: 65,613,472 Q264* probably null Het
Ogfod1 G A 8: 94,063,528 probably null Het
Olfr108 T A 17: 37,445,866 F115Y probably damaging Het
Olfr1453 A G 19: 13,028,299 F10S probably damaging Het
Olfr315 A T 11: 58,778,369 M81L probably benign Het
Olfr490 A G 7: 108,286,271 V285A probably benign Het
Per1 T A 11: 69,102,277 I340N probably damaging Het
Pkhd1 C T 1: 20,381,547 A2175T probably benign Het
Pogk A G 1: 166,403,602 V52A probably damaging Het
Ppib A T 9: 66,066,319 T185S possibly damaging Het
Ptar1 G T 19: 23,720,199 M358I probably damaging Het
Qser1 A C 2: 104,762,881 I1597S probably damaging Het
Ranbp17 T C 11: 33,474,896 I487V probably benign Het
Repin1 C A 6: 48,597,525 R460S probably damaging Het
Sfmbt1 T C 14: 30,787,617 probably benign Het
Sh3rf1 C T 8: 61,393,662 probably benign Het
Shroom3 C T 5: 92,780,903 R106C probably damaging Het
Siglecf T A 7: 43,355,975 V453D probably damaging Het
Slc2a9 A G 5: 38,453,169 S96P probably damaging Het
Slc5a2 A G 7: 128,267,482 Y124C probably damaging Het
Slf1 A G 13: 77,105,969 probably benign Het
Smad1 T G 8: 79,349,782 K269T probably benign Het
Srp54b G A 12: 55,250,099 R194H probably damaging Het
St8sia6 T A 2: 13,665,436 S238C probably damaging Het
Stat3 A T 11: 100,889,937 probably benign Het
Tas1r2 T A 4: 139,655,354 M101K possibly damaging Het
Tesc A G 5: 118,053,582 probably null Het
Tle3 T A 9: 61,410,071 M334K probably damaging Het
Tmem151a A T 19: 5,082,233 V315E probably damaging Het
Tmprss2 T C 16: 97,567,045 D480G probably damaging Het
Trmt1 C A 8: 84,697,112 probably null Het
Tsr3 T C 17: 25,242,224 probably null Het
Ube2u A G 4: 100,481,648 K37E probably benign Het
Usp16 T A 16: 87,475,446 D382E probably damaging Het
Usp9y A T Y: 1,340,053 F1442Y probably damaging Het
Utp20 A T 10: 88,818,595 M210K probably damaging Het
V1ra8 C T 6: 90,203,009 L65F possibly damaging Het
Vmn2r10 T C 5: 109,001,993 N395S probably damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp330 G A 8: 82,764,882 Q221* probably null Het
Other mutations in Col16a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Col16a1 APN 4 130094552 splice site probably null
IGL00885:Col16a1 APN 4 130096910 missense probably damaging 1.00
IGL01931:Col16a1 APN 4 130072841 missense possibly damaging 0.47
IGL02142:Col16a1 APN 4 130051647 splice site probably null
IGL02307:Col16a1 APN 4 130059009 missense probably damaging 1.00
IGL02731:Col16a1 APN 4 130053530 unclassified probably benign
IGL02742:Col16a1 APN 4 130061379 unclassified probably benign
PIT4520001:Col16a1 UTSW 4 130051663 missense unknown
R0127:Col16a1 UTSW 4 130052857 missense probably damaging 1.00
R0131:Col16a1 UTSW 4 130067096 missense unknown
R0131:Col16a1 UTSW 4 130067096 missense unknown
R0132:Col16a1 UTSW 4 130067096 missense unknown
R0299:Col16a1 UTSW 4 130058318 frame shift probably null
R0355:Col16a1 UTSW 4 130058413 splice site probably benign
R0485:Col16a1 UTSW 4 130090497 splice site probably benign
R0573:Col16a1 UTSW 4 130068475 splice site probably benign
R1274:Col16a1 UTSW 4 130097801 missense probably damaging 0.98
R1619:Col16a1 UTSW 4 130098940 missense probably damaging 1.00
R1759:Col16a1 UTSW 4 130084269 missense probably damaging 1.00
R1832:Col16a1 UTSW 4 130077057 splice site probably null
R1861:Col16a1 UTSW 4 130061724 unclassified probably benign
R1862:Col16a1 UTSW 4 130092782 critical splice donor site probably null
R1981:Col16a1 UTSW 4 130065443 missense unknown
R2265:Col16a1 UTSW 4 130052918 missense probably benign 0.02
R2269:Col16a1 UTSW 4 130052918 missense probably benign 0.02
R2291:Col16a1 UTSW 4 130067040 missense unknown
R3176:Col16a1 UTSW 4 130057999 missense probably damaging 0.99
R3276:Col16a1 UTSW 4 130057999 missense probably damaging 0.99
R3552:Col16a1 UTSW 4 130077041 missense probably benign 0.10
R4049:Col16a1 UTSW 4 130068752 missense probably damaging 1.00
R4241:Col16a1 UTSW 4 130099050 missense probably damaging 0.98
R4327:Col16a1 UTSW 4 130094551 critical splice donor site probably null
R4591:Col16a1 UTSW 4 130061799 splice site probably null
R4664:Col16a1 UTSW 4 130062090 unclassified probably benign
R4803:Col16a1 UTSW 4 130055108 unclassified probably benign
R4925:Col16a1 UTSW 4 130054176 missense probably damaging 1.00
R4961:Col16a1 UTSW 4 130054479 splice site probably null
R5016:Col16a1 UTSW 4 130079195 missense probably benign 0.31
R5027:Col16a1 UTSW 4 130079195 missense probably benign 0.31
R5085:Col16a1 UTSW 4 130054171 missense probably damaging 1.00
R5088:Col16a1 UTSW 4 130079195 missense probably benign 0.31
R5089:Col16a1 UTSW 4 130079195 missense probably benign 0.31
R5408:Col16a1 UTSW 4 130093105 utr 3 prime probably benign
R5472:Col16a1 UTSW 4 130092771 utr 3 prime probably benign
R5564:Col16a1 UTSW 4 130053358 missense probably damaging 1.00
R5597:Col16a1 UTSW 4 130058304 missense probably damaging 1.00
R5703:Col16a1 UTSW 4 130053299 missense probably damaging 0.96
R6054:Col16a1 UTSW 4 130061722 unclassified probably benign
R6226:Col16a1 UTSW 4 130055089 unclassified probably benign
R6362:Col16a1 UTSW 4 130066190 missense unknown
R6448:Col16a1 UTSW 4 130058988 missense probably damaging 1.00
R6449:Col16a1 UTSW 4 130066693 missense unknown
R6502:Col16a1 UTSW 4 130055994 missense probably damaging 1.00
R6949:Col16a1 UTSW 4 130059323 missense probably damaging 1.00
R6969:Col16a1 UTSW 4 130093087 utr 3 prime probably benign
R7086:Col16a1 UTSW 4 130052980 splice site probably null
R7375:Col16a1 UTSW 4 130065501 missense unknown
R7703:Col16a1 UTSW 4 130096502 missense unknown
R7808:Col16a1 UTSW 4 130073264 missense unknown
R7904:Col16a1 UTSW 4 130054208 nonsense probably null
R7987:Col16a1 UTSW 4 130054208 nonsense probably null
RF014:Col16a1 UTSW 4 130093067 critical splice acceptor site probably benign
Z1176:Col16a1 UTSW 4 130072878 missense not run
Predicted Primers PCR Primer
(F):5'- CATGGCATCTCCGTTCCTAAAGCTC -3'
(R):5'- TACCTGCAATCCAGGCATTCCG -3'

Sequencing Primer
(F):5'- AGATGAGGTTCCAGACTCTCC -3'
(R):5'- AAGAGAGCTCCCTGCCA -3'
Posted On2013-04-24