Incidental Mutation 'R4212:Islr2'
ID319249
Institutional Source Beutler Lab
Gene Symbol Islr2
Ensembl Gene ENSMUSG00000051243
Gene Nameimmunoglobulin superfamily containing leucine-rich repeat 2
SynonymsLinx, mbu-3, B930052A04Rik
MMRRC Submission 041641-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4212 (G1)
Quality Score122
Status Not validated
Chromosome9
Chromosomal Location58196297-58204319 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 58199320 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 219 (G219D)
Ref Sequence ENSEMBL: ENSMUSP00000149095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114144] [ENSMUST00000163200] [ENSMUST00000163897] [ENSMUST00000165276] [ENSMUST00000170421] [ENSMUST00000214647] [ENSMUST00000214649] [ENSMUST00000215950] [ENSMUST00000217578] [ENSMUST00000216297] [ENSMUST00000217050] [ENSMUST00000217427] [ENSMUST00000216231] [ENSMUST00000217512]
Predicted Effect probably damaging
Transcript: ENSMUST00000114144
AA Change: G219D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109781
Gene: ENSMUSG00000051243
AA Change: G219D

DomainStartEndE-ValueType
LRRNT 19 55 1.1e-1 SMART
LRR 49 73 8.24e0 SMART
LRR 98 121 1.91e1 SMART
LRR 122 145 3.07e-1 SMART
LRR_TYP 146 169 1.58e-3 SMART
LRRCT 181 231 2.36e-12 SMART
IG 245 374 2.99e-2 SMART
low complexity region 510 535 N/A INTRINSIC
transmembrane domain 591 613 N/A INTRINSIC
low complexity region 662 682 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163200
AA Change: G263D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130879
Gene: ENSMUSG00000051243
AA Change: G263D

DomainStartEndE-ValueType
LRRNT 63 99 1.1e-1 SMART
LRR 93 117 8.24e0 SMART
LRR 142 165 1.91e1 SMART
LRR 166 189 3.07e-1 SMART
LRR_TYP 190 213 1.58e-3 SMART
LRRCT 225 275 2.36e-12 SMART
IG 289 418 2.99e-2 SMART
low complexity region 554 579 N/A INTRINSIC
transmembrane domain 635 657 N/A INTRINSIC
low complexity region 706 726 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163897
AA Change: G219D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130322
Gene: ENSMUSG00000051243
AA Change: G219D

DomainStartEndE-ValueType
LRRNT 19 55 1.1e-1 SMART
LRR 49 73 8.24e0 SMART
LRR 98 121 1.91e1 SMART
LRR 122 145 3.07e-1 SMART
LRR_TYP 146 169 1.58e-3 SMART
LRRCT 181 231 2.36e-12 SMART
IG 245 374 2.99e-2 SMART
low complexity region 510 535 N/A INTRINSIC
transmembrane domain 591 613 N/A INTRINSIC
low complexity region 662 682 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165276
AA Change: G219D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129328
Gene: ENSMUSG00000051243
AA Change: G219D

DomainStartEndE-ValueType
LRRNT 19 55 1.1e-1 SMART
LRR 49 73 8.24e0 SMART
LRR 98 121 1.91e1 SMART
LRR 122 145 3.07e-1 SMART
LRR_TYP 146 169 1.58e-3 SMART
LRRCT 181 231 2.36e-12 SMART
IG 245 374 2.99e-2 SMART
low complexity region 510 535 N/A INTRINSIC
transmembrane domain 591 613 N/A INTRINSIC
low complexity region 662 682 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170421
AA Change: G219D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127228
Gene: ENSMUSG00000051243
AA Change: G219D

DomainStartEndE-ValueType
LRRNT 19 55 1.1e-1 SMART
LRR 49 73 8.24e0 SMART
LRR 98 121 1.91e1 SMART
LRR 122 145 3.07e-1 SMART
LRR_TYP 146 169 1.58e-3 SMART
LRRCT 181 231 2.36e-12 SMART
IG 245 374 2.99e-2 SMART
low complexity region 510 535 N/A INTRINSIC
transmembrane domain 591 613 N/A INTRINSIC
low complexity region 662 682 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179787
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213495
Predicted Effect probably benign
Transcript: ENSMUST00000214647
Predicted Effect probably benign
Transcript: ENSMUST00000214649
Predicted Effect probably damaging
Transcript: ENSMUST00000215950
AA Change: G219D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000217578
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216359
Predicted Effect probably benign
Transcript: ENSMUST00000216297
Predicted Effect probably benign
Transcript: ENSMUST00000217050
Predicted Effect probably benign
Transcript: ENSMUST00000217427
Predicted Effect probably benign
Transcript: ENSMUST00000216231
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217158
Predicted Effect probably benign
Transcript: ENSMUST00000217512
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit perinatal lethality, absent tail pinch response, and defective peroneal and tibial nerve morphology and branch extension. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik C T 13: 58,381,991 G269E probably damaging Het
A1bg G T 15: 60,919,736 L284M possibly damaging Het
Adamts15 A G 9: 30,906,174 V536A probably damaging Het
AI464131 T C 4: 41,498,307 E441G probably benign Het
Arsi A T 18: 60,916,701 I219F probably damaging Het
Atg7 G A 6: 114,703,425 G447E probably benign Het
Bdp1 T A 13: 100,059,585 H1223L probably benign Het
Cep152 A G 2: 125,620,001 M87T probably benign Het
Chrm3 T C 13: 9,877,755 D415G probably benign Het
Chrnb2 A T 3: 89,761,544 C155S probably damaging Het
Col6a4 T A 9: 106,075,370 Q443L probably benign Het
D5Ertd579e A T 5: 36,614,479 D857E probably damaging Het
Efcab6 T C 15: 83,892,863 D1124G probably damaging Het
F830045P16Rik C T 2: 129,460,353 A440T probably benign Het
Gc T C 5: 89,435,575 K370E probably benign Het
Gm11559 A G 11: 99,864,900 Q125R unknown Het
Gm3985 A T 8: 32,942,456 noncoding transcript Het
Gm648 C T X: 56,545,208 V78I probably benign Het
Gm8765 C T 13: 50,700,352 T82I possibly damaging Het
Gucy2e A G 11: 69,228,123 F681S probably damaging Het
Hip1r A G 5: 123,999,890 I760V probably benign Het
Itgae A G 11: 73,119,352 H556R probably benign Het
Jag1 T C 2: 137,085,070 D923G probably benign Het
Kmt2c A G 5: 25,347,359 probably null Het
Kmt2d A G 15: 98,845,003 probably benign Het
Krtap17-1 A G 11: 99,993,914 L9P unknown Het
Lats2 C T 14: 57,696,255 D802N possibly damaging Het
Lrfn5 A T 12: 61,843,820 T632S probably benign Het
Myo9a C T 9: 59,906,066 R2183* probably null Het
Naip1 T C 13: 100,426,875 probably null Het
Nf1 T A 11: 79,469,798 V1434E probably damaging Het
Nlrc4 T C 17: 74,447,115 Y91C possibly damaging Het
Olfr1454 T G 19: 13,063,759 M116R probably damaging Het
Olfr173 T A 16: 58,797,369 H159L possibly damaging Het
Olfr723 A T 14: 49,928,889 Y218* probably null Het
Pard3 T A 8: 127,610,458 I1143K probably benign Het
Pcdha7 A G 18: 36,974,974 T351A probably benign Het
Phf2 C A 13: 48,820,613 G318V unknown Het
Plch1 T A 3: 63,870,759 probably benign Het
Polr1c A G 17: 46,246,120 I79T probably damaging Het
Ppp2r5e A G 12: 75,469,551 I244T probably damaging Het
Psmd12 T C 11: 107,485,759 C74R probably damaging Het
Ralgapa1 A G 12: 55,739,330 probably null Het
Robo3 C T 9: 37,421,898 G781D probably damaging Het
Scn8a T C 15: 100,957,073 V147A possibly damaging Het
Sema3b C T 9: 107,603,398 V117M probably damaging Het
Sfxn5 A T 6: 85,332,306 L139* probably null Het
Slc2a12 A T 10: 22,702,094 K596N probably benign Het
Sorcs1 G A 19: 50,225,175 R705C probably damaging Het
Tlr4 T A 4: 66,840,326 I452N probably damaging Het
Tshz3 A G 7: 36,770,119 D511G probably damaging Het
Usp44 A G 10: 93,846,770 K314E possibly damaging Het
Other mutations in Islr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Islr2 APN 9 58199786 missense probably benign 0.03
IGL01444:Islr2 APN 9 58198378 missense probably damaging 1.00
R0346:Islr2 UTSW 9 58198343 nonsense probably null
R0360:Islr2 UTSW 9 58199744 missense possibly damaging 0.82
R0364:Islr2 UTSW 9 58199744 missense possibly damaging 0.82
R0528:Islr2 UTSW 9 58199362 missense probably damaging 0.97
R0693:Islr2 UTSW 9 58199744 missense possibly damaging 0.82
R1854:Islr2 UTSW 9 58199816 missense probably damaging 0.97
R2893:Islr2 UTSW 9 58197866 missense probably damaging 1.00
R3747:Islr2 UTSW 9 58199642 missense probably benign 0.00
R3914:Islr2 UTSW 9 58198383 nonsense probably null
R4176:Islr2 UTSW 9 58199900 missense probably damaging 1.00
R4844:Islr2 UTSW 9 58208234 unclassified probably benign
R5303:Islr2 UTSW 9 58208275 unclassified probably benign
R5636:Islr2 UTSW 9 58201301 missense probably benign 0.03
R5787:Islr2 UTSW 9 58198354 missense probably damaging 0.97
R5883:Islr2 UTSW 9 58198715 missense probably benign 0.01
R6406:Islr2 UTSW 9 58199980 missense probably benign
R7105:Islr2 UTSW 9 58197814 missense probably damaging 1.00
R7130:Islr2 UTSW 9 58198292 missense probably damaging 1.00
R7316:Islr2 UTSW 9 58197967 missense probably damaging 0.99
X0026:Islr2 UTSW 9 58198286 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGCACTAAGACTACAGTGC -3'
(R):5'- GCTCTCTGCGCATCAACAAC -3'

Sequencing Primer
(F):5'- CCACCCGGGATCTGAAGTTG -3'
(R):5'- ACAACCGGCTGCGTACC -3'
Posted On2015-06-10