Incidental Mutation 'R4212:Usp44'
ID319254
Institutional Source Beutler Lab
Gene Symbol Usp44
Ensembl Gene ENSMUSG00000020020
Gene Nameubiquitin specific peptidase 44
Synonyms
MMRRC Submission 041641-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4212 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location93831555-93858088 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93846770 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 314 (K314E)
Ref Sequence ENSEMBL: ENSMUSP00000092975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095333] [ENSMUST00000216224]
Predicted Effect possibly damaging
Transcript: ENSMUST00000095333
AA Change: K314E

PolyPhen 2 Score 0.551 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000092975
Gene: ENSMUSG00000020020
AA Change: K314E

DomainStartEndE-ValueType
Pfam:zf-UBP 26 88 5.4e-23 PFAM
Pfam:UCH 161 480 3.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216224
AA Change: K361E

PolyPhen 2 Score 0.434 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a protease that functions as a deubiquitinating enzyme. The encoded protein is thought to help regulate the spindle assembly checkpoint by preventing early anaphase onset. This protein specifically deubiquitinates CDC20, which stabilizes the anaphase promoting complex/cyclosome. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit chromosomal instability, aneuploidy and increased tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik C T 13: 58,381,991 G269E probably damaging Het
A1bg G T 15: 60,919,736 L284M possibly damaging Het
Adamts15 A G 9: 30,906,174 V536A probably damaging Het
AI464131 T C 4: 41,498,307 E441G probably benign Het
Arsi A T 18: 60,916,701 I219F probably damaging Het
Atg7 G A 6: 114,703,425 G447E probably benign Het
Bdp1 T A 13: 100,059,585 H1223L probably benign Het
Cep152 A G 2: 125,620,001 M87T probably benign Het
Chrm3 T C 13: 9,877,755 D415G probably benign Het
Chrnb2 A T 3: 89,761,544 C155S probably damaging Het
Col6a4 T A 9: 106,075,370 Q443L probably benign Het
D5Ertd579e A T 5: 36,614,479 D857E probably damaging Het
Efcab6 T C 15: 83,892,863 D1124G probably damaging Het
F830045P16Rik C T 2: 129,460,353 A440T probably benign Het
Gc T C 5: 89,435,575 K370E probably benign Het
Gm11559 A G 11: 99,864,900 Q125R unknown Het
Gm3985 A T 8: 32,942,456 noncoding transcript Het
Gm648 C T X: 56,545,208 V78I probably benign Het
Gm8765 C T 13: 50,700,352 T82I possibly damaging Het
Gucy2e A G 11: 69,228,123 F681S probably damaging Het
Hip1r A G 5: 123,999,890 I760V probably benign Het
Islr2 C T 9: 58,199,320 G219D probably damaging Het
Itgae A G 11: 73,119,352 H556R probably benign Het
Jag1 T C 2: 137,085,070 D923G probably benign Het
Kmt2c A G 5: 25,347,359 probably null Het
Kmt2d A G 15: 98,845,003 probably benign Het
Krtap17-1 A G 11: 99,993,914 L9P unknown Het
Lats2 C T 14: 57,696,255 D802N possibly damaging Het
Lrfn5 A T 12: 61,843,820 T632S probably benign Het
Myo9a C T 9: 59,906,066 R2183* probably null Het
Naip1 T C 13: 100,426,875 probably null Het
Nf1 T A 11: 79,469,798 V1434E probably damaging Het
Nlrc4 T C 17: 74,447,115 Y91C possibly damaging Het
Olfr1454 T G 19: 13,063,759 M116R probably damaging Het
Olfr173 T A 16: 58,797,369 H159L possibly damaging Het
Olfr723 A T 14: 49,928,889 Y218* probably null Het
Pard3 T A 8: 127,610,458 I1143K probably benign Het
Pcdha7 A G 18: 36,974,974 T351A probably benign Het
Phf2 C A 13: 48,820,613 G318V unknown Het
Plch1 T A 3: 63,870,759 probably benign Het
Polr1c A G 17: 46,246,120 I79T probably damaging Het
Ppp2r5e A G 12: 75,469,551 I244T probably damaging Het
Psmd12 T C 11: 107,485,759 C74R probably damaging Het
Ralgapa1 A G 12: 55,739,330 probably null Het
Robo3 C T 9: 37,421,898 G781D probably damaging Het
Scn8a T C 15: 100,957,073 V147A possibly damaging Het
Sema3b C T 9: 107,603,398 V117M probably damaging Het
Sfxn5 A T 6: 85,332,306 L139* probably null Het
Slc2a12 A T 10: 22,702,094 K596N probably benign Het
Sorcs1 G A 19: 50,225,175 R705C probably damaging Het
Tlr4 T A 4: 66,840,326 I452N probably damaging Het
Tshz3 A G 7: 36,770,119 D511G probably damaging Het
Other mutations in Usp44
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4378001:Usp44 UTSW 10 93845655 start gained probably benign
R0497:Usp44 UTSW 10 93846806 missense possibly damaging 0.77
R0789:Usp44 UTSW 10 93847220 intron probably benign
R1521:Usp44 UTSW 10 93847186 nonsense probably null
R4032:Usp44 UTSW 10 93847265 intron probably benign
R4755:Usp44 UTSW 10 93846906 missense probably damaging 1.00
R4764:Usp44 UTSW 10 93846071 missense probably benign 0.17
R5095:Usp44 UTSW 10 93846845 missense possibly damaging 0.70
R5775:Usp44 UTSW 10 93845978 missense possibly damaging 0.80
R6029:Usp44 UTSW 10 93846632 missense probably damaging 0.96
R6193:Usp44 UTSW 10 93847148 intron probably benign
R6233:Usp44 UTSW 10 93850340 missense probably damaging 1.00
R6338:Usp44 UTSW 10 93846513 missense probably damaging 1.00
R6374:Usp44 UTSW 10 93856310 missense probably benign 0.12
R6556:Usp44 UTSW 10 93846008 missense probably benign 0.20
R6615:Usp44 UTSW 10 93846489 missense possibly damaging 0.48
R7099:Usp44 UTSW 10 93850187 missense possibly damaging 0.95
R7224:Usp44 UTSW 10 93845993 missense probably benign 0.08
R7361:Usp44 UTSW 10 93846468 missense probably benign 0.00
R7576:Usp44 UTSW 10 93846428 missense probably damaging 0.99
R8014:Usp44 UTSW 10 93852709 critical splice acceptor site probably null
R8695:Usp44 UTSW 10 93846503 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTGACCTGAACCAGTGG -3'
(R):5'- CGTTGTATCTTATCCAGAAGTTCAC -3'

Sequencing Primer
(F):5'- CCAGTGGCTGGCTGTGG -3'
(R):5'- AGAAATTCCTGAGCATCCTGC -3'
Posted On2015-06-10