Incidental Mutation 'R4212:Psmd12'
ID319260
Institutional Source Beutler Lab
Gene Symbol Psmd12
Ensembl Gene ENSMUSG00000020720
Gene Nameproteasome (prosome, macropain) 26S subunit, non-ATPase, 12
Synonyms1500002F15Rik, P55
MMRRC Submission 041641-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R4212 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location107479484-107504362 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107485759 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 74 (C74R)
Ref Sequence ENSEMBL: ENSMUSP00000021063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021063] [ENSMUST00000106750] [ENSMUST00000106752]
Predicted Effect probably damaging
Transcript: ENSMUST00000021063
AA Change: C74R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021063
Gene: ENSMUSG00000020720
AA Change: C74R

DomainStartEndE-ValueType
PINT 349 435 3.24e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106750
AA Change: C54R

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102361
Gene: ENSMUSG00000020720
AA Change: C54R

DomainStartEndE-ValueType
PINT 329 415 3.24e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106752
AA Change: C74R

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102363
Gene: ENSMUSG00000020720
AA Change: C74R

DomainStartEndE-ValueType
Pfam:PCI 300 398 1.3e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138702
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a non-ATPase subunit of the 19S regulator. A pseudogene has been identified on chromosome 3. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik C T 13: 58,381,991 G269E probably damaging Het
A1bg G T 15: 60,919,736 L284M possibly damaging Het
Adamts15 A G 9: 30,906,174 V536A probably damaging Het
AI464131 T C 4: 41,498,307 E441G probably benign Het
Arsi A T 18: 60,916,701 I219F probably damaging Het
Atg7 G A 6: 114,703,425 G447E probably benign Het
Bdp1 T A 13: 100,059,585 H1223L probably benign Het
Cep152 A G 2: 125,620,001 M87T probably benign Het
Chrm3 T C 13: 9,877,755 D415G probably benign Het
Chrnb2 A T 3: 89,761,544 C155S probably damaging Het
Col6a4 T A 9: 106,075,370 Q443L probably benign Het
D5Ertd579e A T 5: 36,614,479 D857E probably damaging Het
Efcab6 T C 15: 83,892,863 D1124G probably damaging Het
F830045P16Rik C T 2: 129,460,353 A440T probably benign Het
Gc T C 5: 89,435,575 K370E probably benign Het
Gm11559 A G 11: 99,864,900 Q125R unknown Het
Gm3985 A T 8: 32,942,456 noncoding transcript Het
Gm648 C T X: 56,545,208 V78I probably benign Het
Gm8765 C T 13: 50,700,352 T82I possibly damaging Het
Gucy2e A G 11: 69,228,123 F681S probably damaging Het
Hip1r A G 5: 123,999,890 I760V probably benign Het
Islr2 C T 9: 58,199,320 G219D probably damaging Het
Itgae A G 11: 73,119,352 H556R probably benign Het
Jag1 T C 2: 137,085,070 D923G probably benign Het
Kmt2c A G 5: 25,347,359 probably null Het
Kmt2d A G 15: 98,845,003 probably benign Het
Krtap17-1 A G 11: 99,993,914 L9P unknown Het
Lats2 C T 14: 57,696,255 D802N possibly damaging Het
Lrfn5 A T 12: 61,843,820 T632S probably benign Het
Myo9a C T 9: 59,906,066 R2183* probably null Het
Naip1 T C 13: 100,426,875 probably null Het
Nf1 T A 11: 79,469,798 V1434E probably damaging Het
Nlrc4 T C 17: 74,447,115 Y91C possibly damaging Het
Olfr1454 T G 19: 13,063,759 M116R probably damaging Het
Olfr173 T A 16: 58,797,369 H159L possibly damaging Het
Olfr723 A T 14: 49,928,889 Y218* probably null Het
Pard3 T A 8: 127,610,458 I1143K probably benign Het
Pcdha7 A G 18: 36,974,974 T351A probably benign Het
Phf2 C A 13: 48,820,613 G318V unknown Het
Plch1 T A 3: 63,870,759 probably benign Het
Polr1c A G 17: 46,246,120 I79T probably damaging Het
Ppp2r5e A G 12: 75,469,551 I244T probably damaging Het
Ralgapa1 A G 12: 55,739,330 probably null Het
Robo3 C T 9: 37,421,898 G781D probably damaging Het
Scn8a T C 15: 100,957,073 V147A possibly damaging Het
Sema3b C T 9: 107,603,398 V117M probably damaging Het
Sfxn5 A T 6: 85,332,306 L139* probably null Het
Slc2a12 A T 10: 22,702,094 K596N probably benign Het
Sorcs1 G A 19: 50,225,175 R705C probably damaging Het
Tlr4 T A 4: 66,840,326 I452N probably damaging Het
Tshz3 A G 7: 36,770,119 D511G probably damaging Het
Usp44 A G 10: 93,846,770 K314E possibly damaging Het
Other mutations in Psmd12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03002:Psmd12 APN 11 107485781 missense probably benign 0.00
R0384:Psmd12 UTSW 11 107485721 missense probably benign 0.00
R1457:Psmd12 UTSW 11 107479646 missense probably damaging 1.00
R1661:Psmd12 UTSW 11 107491906 missense probably damaging 1.00
R2443:Psmd12 UTSW 11 107495737 missense probably damaging 1.00
R3806:Psmd12 UTSW 11 107495765 missense probably benign 0.03
R3807:Psmd12 UTSW 11 107495765 missense probably benign 0.03
R3840:Psmd12 UTSW 11 107485572 missense probably benign 0.02
R4718:Psmd12 UTSW 11 107486433 missense probably benign 0.15
R5182:Psmd12 UTSW 11 107479659 missense probably damaging 1.00
R5586:Psmd12 UTSW 11 107486475 missense probably benign 0.35
R6171:Psmd12 UTSW 11 107491907 missense probably damaging 0.96
R6444:Psmd12 UTSW 11 107486454 missense possibly damaging 0.55
R6527:Psmd12 UTSW 11 107488968 missense probably damaging 0.96
R7276:Psmd12 UTSW 11 107503645 nonsense probably null
R7466:Psmd12 UTSW 11 107492057 missense probably benign 0.03
R7751:Psmd12 UTSW 11 107479613 missense possibly damaging 0.68
R7779:Psmd12 UTSW 11 107497579 missense probably benign 0.01
R8373:Psmd12 UTSW 11 107497624 missense probably damaging 0.98
Z1177:Psmd12 UTSW 11 107485557 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- AGAAGTCATCGAAACCCTTCTCTC -3'
(R):5'- TGGGAACAGCTGAAACATTGTAATG -3'

Sequencing Primer
(F):5'- TTCTCTCTCTAGAAAAGCAGACCCG -3'
(R):5'- TCAGAAGATACCTTGCAGGCGTC -3'
Posted On2015-06-10