Mutagenetix > Incidental Mutation

Incidental Mutation 'R4212:Kmt2d'

319274

Institutional Source

Beutler Lab

Gene Symbol

Kmt2d

Ensembl Gene

ENSMUSG00000048154

Gene Name

lysine (K)-specific methyltransferase 2D

Synonyms

Mll2, C430014K11Rik, Mll4

MMRRC Submission

041641-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4212 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

98831669-98871204 bp(-) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

A to G at 98845003 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023741] [ENSMUST00000178486]

AlphaFold

no structure available at present

Predicted Effect

unknown
Transcript: ENSMUST00000023741
AA Change: V4092A

SMART Domains

Protein: ENSMUSP00000023741
Gene: ENSMUSG00000048154
AA Change: V4092A

Domain	Start	End	E-Value	Type
low complexity region	135	145	N/A	INTRINSIC
PHD	171	218	1.65e-5	SMART
RING	172	217	2.01e0	SMART
PHD	228	274	2.13e-8	SMART
RING	229	273	2.11e-3	SMART
PHD	275	321	1.57e-11	SMART
RING	276	320	2.36e0	SMART
low complexity region	430	489	N/A	INTRINSIC
low complexity region	500	562	N/A	INTRINSIC
low complexity region	564	613	N/A	INTRINSIC
low complexity region	619	717	N/A	INTRINSIC
internal_repeat_3	719	768	2.82e-8	PROSPERO
internal_repeat_3	773	822	2.82e-8	PROSPERO
low complexity region	826	842	N/A	INTRINSIC
low complexity region	844	919	N/A	INTRINSIC
low complexity region	958	981	N/A	INTRINSIC
low complexity region	985	1023	N/A	INTRINSIC
low complexity region	1069	1076	N/A	INTRINSIC
low complexity region	1139	1153	N/A	INTRINSIC
low complexity region	1259	1285	N/A	INTRINSIC
low complexity region	1307	1314	N/A	INTRINSIC
PHD	1335	1384	7.01e-9	SMART
RING	1336	1383	1.46e1	SMART
PHD	1385	1431	8.56e-13	SMART
PHD	1462	1513	1.11e-6	SMART
RING	1463	1512	1.46e1	SMART
low complexity region	1514	1538	N/A	INTRINSIC
low complexity region	1567	1576	N/A	INTRINSIC
low complexity region	1589	1612	N/A	INTRINSIC
low complexity region	1634	1646	N/A	INTRINSIC
low complexity region	1707	1719	N/A	INTRINSIC
low complexity region	1883	1896	N/A	INTRINSIC
low complexity region	1931	1950	N/A	INTRINSIC
HMG	1969	2037	6.35e-6	SMART
low complexity region	2064	2079	N/A	INTRINSIC
low complexity region	2147	2167	N/A	INTRINSIC
low complexity region	2170	2181	N/A	INTRINSIC
low complexity region	2306	2323	N/A	INTRINSIC
low complexity region	2334	2359	N/A	INTRINSIC
low complexity region	2366	2388	N/A	INTRINSIC
low complexity region	2402	2419	N/A	INTRINSIC
low complexity region	2546	2559	N/A	INTRINSIC
low complexity region	2610	2622	N/A	INTRINSIC
coiled coil region	2632	2665	N/A	INTRINSIC
coiled coil region	2768	2813	N/A	INTRINSIC
low complexity region	2855	2868	N/A	INTRINSIC
low complexity region	2887	2899	N/A	INTRINSIC
low complexity region	3151	3165	N/A	INTRINSIC
low complexity region	3189	3204	N/A	INTRINSIC
low complexity region	3241	3263	N/A	INTRINSIC
low complexity region	3390	3400	N/A	INTRINSIC
low complexity region	3629	3659	N/A	INTRINSIC
coiled coil region	3712	3749	N/A	INTRINSIC
low complexity region	3781	3801	N/A	INTRINSIC
coiled coil region	3910	4003	N/A	INTRINSIC
low complexity region	4128	4159	N/A	INTRINSIC
low complexity region	4167	4183	N/A	INTRINSIC
low complexity region	4226	4246	N/A	INTRINSIC
low complexity region	4266	4293	N/A	INTRINSIC
low complexity region	4306	4322	N/A	INTRINSIC
low complexity region	4361	4378	N/A	INTRINSIC
coiled coil region	4591	4613	N/A	INTRINSIC
low complexity region	4661	4684	N/A	INTRINSIC
low complexity region	4745	4755	N/A	INTRINSIC
low complexity region	4877	4896	N/A	INTRINSIC
low complexity region	4957	4983	N/A	INTRINSIC
low complexity region	4989	5029	N/A	INTRINSIC
low complexity region	5100	5107	N/A	INTRINSIC
PHD	5142	5188	4.67e-5	SMART
RING	5143	5187	4.87e0	SMART
FYRN	5242	5285	5.07e-21	SMART
FYRC	5291	5378	2.51e-43	SMART
SET	5448	5570	5.69e-36	SMART
PostSET	5572	5588	3.58e-5	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000178486
AA Change: V4092A

SMART Domains

Protein: ENSMUSP00000135941
Gene: ENSMUSG00000048154
AA Change: V4092A

Domain	Start	End	E-Value	Type
low complexity region	135	145	N/A	INTRINSIC
PHD	171	218	1.65e-5	SMART
RING	172	217	2.01e0	SMART
PHD	228	274	2.13e-8	SMART
RING	229	273	2.11e-3	SMART
PHD	275	321	1.57e-11	SMART
RING	276	320	2.36e0	SMART
low complexity region	430	489	N/A	INTRINSIC
low complexity region	500	562	N/A	INTRINSIC
low complexity region	564	613	N/A	INTRINSIC
low complexity region	619	717	N/A	INTRINSIC
internal_repeat_3	719	768	2.82e-8	PROSPERO
internal_repeat_3	773	822	2.82e-8	PROSPERO
low complexity region	826	842	N/A	INTRINSIC
low complexity region	844	919	N/A	INTRINSIC
low complexity region	958	981	N/A	INTRINSIC
low complexity region	985	1023	N/A	INTRINSIC
low complexity region	1069	1076	N/A	INTRINSIC
low complexity region	1139	1153	N/A	INTRINSIC
low complexity region	1259	1285	N/A	INTRINSIC
low complexity region	1307	1314	N/A	INTRINSIC
PHD	1335	1384	7.01e-9	SMART
RING	1336	1383	1.46e1	SMART
PHD	1385	1431	8.56e-13	SMART
PHD	1462	1513	1.11e-6	SMART
RING	1463	1512	1.46e1	SMART
low complexity region	1514	1538	N/A	INTRINSIC
low complexity region	1567	1576	N/A	INTRINSIC
low complexity region	1589	1612	N/A	INTRINSIC
low complexity region	1634	1646	N/A	INTRINSIC
low complexity region	1707	1719	N/A	INTRINSIC
low complexity region	1883	1896	N/A	INTRINSIC
low complexity region	1931	1950	N/A	INTRINSIC
HMG	1969	2037	6.35e-6	SMART
low complexity region	2064	2079	N/A	INTRINSIC
low complexity region	2147	2167	N/A	INTRINSIC
low complexity region	2170	2181	N/A	INTRINSIC
low complexity region	2306	2323	N/A	INTRINSIC
low complexity region	2334	2359	N/A	INTRINSIC
low complexity region	2366	2388	N/A	INTRINSIC
low complexity region	2402	2419	N/A	INTRINSIC
low complexity region	2546	2559	N/A	INTRINSIC
low complexity region	2610	2622	N/A	INTRINSIC
coiled coil region	2632	2665	N/A	INTRINSIC
coiled coil region	2768	2813	N/A	INTRINSIC
low complexity region	2855	2868	N/A	INTRINSIC
low complexity region	2887	2899	N/A	INTRINSIC
low complexity region	3151	3165	N/A	INTRINSIC
low complexity region	3189	3204	N/A	INTRINSIC
low complexity region	3241	3263	N/A	INTRINSIC
low complexity region	3390	3400	N/A	INTRINSIC
low complexity region	3629	3659	N/A	INTRINSIC
coiled coil region	3712	3749	N/A	INTRINSIC
low complexity region	3781	3801	N/A	INTRINSIC
coiled coil region	3910	4003	N/A	INTRINSIC
low complexity region	4128	4159	N/A	INTRINSIC
low complexity region	4167	4183	N/A	INTRINSIC
low complexity region	4226	4246	N/A	INTRINSIC
low complexity region	4266	4293	N/A	INTRINSIC
low complexity region	4306	4322	N/A	INTRINSIC
low complexity region	4361	4378	N/A	INTRINSIC
coiled coil region	4591	4613	N/A	INTRINSIC
low complexity region	4661	4684	N/A	INTRINSIC
low complexity region	4745	4755	N/A	INTRINSIC
low complexity region	4877	4896	N/A	INTRINSIC
low complexity region	4957	4983	N/A	INTRINSIC
low complexity region	4989	5029	N/A	INTRINSIC
low complexity region	5100	5107	N/A	INTRINSIC
PHD	5142	5188	4.67e-5	SMART
RING	5143	5187	4.87e0	SMART
FYRN	5242	5285	5.07e-21	SMART
FYRC	5291	5378	2.51e-43	SMART
SET	5448	5570	5.69e-36	SMART
PostSET	5572	5588	3.58e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000229651

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a histone methyltransferase that methylates the Lys-4 position of histone H3. The encoded protein is part of a large protein complex called ASCOM, which has been shown to be a transcriptional regulator of the beta-globin and estrogen receptor genes. Mutations in this gene have been shown to be a cause of Kabuki syndrome. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality around E9.5. Mice homozygous for a conditional allele activated in different cell-types exhibit impaired adipogenesis, impaired myogenesis, perturbed germinal B cell development and promoteion of lymphomagenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210016F16Rik	C	T	13: 58,381,991	G269E	probably damaging	Het
A1bg	G	T	15: 60,919,736	L284M	possibly damaging	Het
Adamts15	A	G	9: 30,906,174	V536A	probably damaging	Het
AI464131	T	C	4: 41,498,307	E441G	probably benign	Het
Arsi	A	T	18: 60,916,701	I219F	probably damaging	Het
Atg7	G	A	6: 114,703,425	G447E	probably benign	Het
Bdp1	T	A	13: 100,059,585	H1223L	probably benign	Het
Cep152	A	G	2: 125,620,001	M87T	probably benign	Het
Chrm3	T	C	13: 9,877,755	D415G	probably benign	Het
Chrnb2	A	T	3: 89,761,544	C155S	probably damaging	Het
Col6a4	T	A	9: 106,075,370	Q443L	probably benign	Het
D5Ertd579e	A	T	5: 36,614,479	D857E	probably damaging	Het
Efcab6	T	C	15: 83,892,863	D1124G	probably damaging	Het
F830045P16Rik	C	T	2: 129,460,353	A440T	probably benign	Het
Gc	T	C	5: 89,435,575	K370E	probably benign	Het
Gm11559	A	G	11: 99,864,900	Q125R	unknown	Het
Gm3985	A	T	8: 32,942,456		noncoding transcript	Het
Gm648	C	T	X: 56,545,208	V78I	probably benign	Het
Gm8765	C	T	13: 50,700,352	T82I	possibly damaging	Het
Gucy2e	A	G	11: 69,228,123	F681S	probably damaging	Het
Hip1r	A	G	5: 123,999,890	I760V	probably benign	Het
Islr2	C	T	9: 58,199,320	G219D	probably damaging	Het
Itgae	A	G	11: 73,119,352	H556R	probably benign	Het
Jag1	T	C	2: 137,085,070	D923G	probably benign	Het
Kmt2c	A	G	5: 25,347,359		probably null	Het
Krtap17-1	A	G	11: 99,993,914	L9P	unknown	Het
Lats2	C	T	14: 57,696,255	D802N	possibly damaging	Het
Lrfn5	A	T	12: 61,843,820	T632S	probably benign	Het
Myo9a	C	T	9: 59,906,066	R2183*	probably null	Het
Naip1	T	C	13: 100,426,875		probably null	Het
Nf1	T	A	11: 79,469,798	V1434E	probably damaging	Het
Nlrc4	T	C	17: 74,447,115	Y91C	possibly damaging	Het
Olfr1454	T	G	19: 13,063,759	M116R	probably damaging	Het
Olfr173	T	A	16: 58,797,369	H159L	possibly damaging	Het
Olfr723	A	T	14: 49,928,889	Y218*	probably null	Het
Pard3	T	A	8: 127,610,458	I1143K	probably benign	Het
Pcdha7	A	G	18: 36,974,974	T351A	probably benign	Het
Phf2	C	A	13: 48,820,613	G318V	unknown	Het
Plch1	T	A	3: 63,870,759		probably benign	Het
Polr1c	A	G	17: 46,246,120	I79T	probably damaging	Het
Ppp2r5e	A	G	12: 75,469,551	I244T	probably damaging	Het
Psmd12	T	C	11: 107,485,759	C74R	probably damaging	Het
Ralgapa1	A	G	12: 55,739,330		probably null	Het
Robo3	C	T	9: 37,421,898	G781D	probably damaging	Het
Scn8a	T	C	15: 100,957,073	V147A	possibly damaging	Het
Sema3b	C	T	9: 107,603,398	V117M	probably damaging	Het
Sfxn5	A	T	6: 85,332,306	L139*	probably null	Het
Slc2a12	A	T	10: 22,702,094	K596N	probably benign	Het
Sorcs1	G	A	19: 50,225,175	R705C	probably damaging	Het
Tlr4	T	A	4: 66,840,326	I452N	probably damaging	Het
Tshz3	A	G	7: 36,770,119	D511G	probably damaging	Het
Usp44	A	G	10: 93,846,770	K314E	possibly damaging	Het

Other mutations in Kmt2d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Kmt2d	APN	15	98862333	missense	unknown
IGL00927:Kmt2d	APN	15	98845009	unclassified	probably benign
IGL01123:Kmt2d	APN	15	98837148	missense	unknown
IGL01288:Kmt2d	APN	15	98865044	missense	probably damaging	1.00
IGL01538:Kmt2d	APN	15	98860657	unclassified	probably benign
IGL01575:Kmt2d	APN	15	98846855	utr 3 prime	probably benign
IGL01584:Kmt2d	APN	15	98856369	unclassified	probably benign
IGL01750:Kmt2d	APN	15	98853168	unclassified	probably benign
IGL02163:Kmt2d	APN	15	98835228	unclassified	probably benign
IGL02209:Kmt2d	APN	15	98854567	unclassified	probably benign
IGL02253:Kmt2d	APN	15	98858175	unclassified	probably benign
IGL02271:Kmt2d	APN	15	98866428	missense	possibly damaging	0.89
IGL02291:Kmt2d	APN	15	98865492	splice site	probably benign
IGL02448:Kmt2d	APN	15	98844110	unclassified	probably benign
IGL02472:Kmt2d	APN	15	98850077	missense	probably benign	0.23
IGL02496:Kmt2d	APN	15	98857558	unclassified	probably benign
IGL02527:Kmt2d	APN	15	98841747	unclassified	probably benign
IGL02576:Kmt2d	APN	15	98864120	missense	unknown
IGL02597:Kmt2d	APN	15	98863831	missense	unknown
IGL02609:Kmt2d	APN	15	98851793	unclassified	probably benign
IGL03085:Kmt2d	APN	15	98839940	unclassified	probably benign
IGL03102:Kmt2d	APN	15	98855543	missense	probably benign
IGL03123:Kmt2d	APN	15	98861771	missense	unknown
G1citation:Kmt2d	UTSW	15	98849459	unclassified	probably benign
R0091:Kmt2d	UTSW	15	98844479	unclassified	probably benign
R0136:Kmt2d	UTSW	15	98854278	unclassified	probably benign
R0243:Kmt2d	UTSW	15	98850137	unclassified	probably benign
R0276:Kmt2d	UTSW	15	98850311	unclassified	probably benign
R0477:Kmt2d	UTSW	15	98853581	unclassified	probably benign
R0478:Kmt2d	UTSW	15	98853581	unclassified	probably benign
R0586:Kmt2d	UTSW	15	98835207	unclassified	probably benign
R0632:Kmt2d	UTSW	15	98853581	unclassified	probably benign
R0678:Kmt2d	UTSW	15	98850413	unclassified	probably benign
R0780:Kmt2d	UTSW	15	98862857	missense	unknown
R0891:Kmt2d	UTSW	15	98852691	unclassified	probably benign
R1136:Kmt2d	UTSW	15	98857765	unclassified	probably benign
R1417:Kmt2d	UTSW	15	98866430	missense	probably damaging	0.99
R1499:Kmt2d	UTSW	15	98844938	unclassified	probably benign
R1510:Kmt2d	UTSW	15	98856377	unclassified	probably benign
R1586:Kmt2d	UTSW	15	98865053	splice site	probably benign
R1640:Kmt2d	UTSW	15	98845057	unclassified	probably benign
R1714:Kmt2d	UTSW	15	98862950	missense	unknown
R1725:Kmt2d	UTSW	15	98845234	unclassified	probably benign
R1728:Kmt2d	UTSW	15	98865132	missense	probably damaging	1.00
R1729:Kmt2d	UTSW	15	98865132	missense	probably damaging	1.00
R1741:Kmt2d	UTSW	15	98845234	unclassified	probably benign
R1744:Kmt2d	UTSW	15	98865047	missense	probably damaging	0.99
R1746:Kmt2d	UTSW	15	98864378	missense	probably damaging	0.97
R1753:Kmt2d	UTSW	15	98843482	unclassified	probably benign
R1782:Kmt2d	UTSW	15	98857548	unclassified	probably benign
R1789:Kmt2d	UTSW	15	98852074	unclassified	probably benign
R1802:Kmt2d	UTSW	15	98862985	missense	unknown
R1808:Kmt2d	UTSW	15	98866686	missense	probably damaging	1.00
R1822:Kmt2d	UTSW	15	98861780	missense	unknown
R1831:Kmt2d	UTSW	15	98855343	missense	probably damaging	0.97
R1920:Kmt2d	UTSW	15	98855590	missense	probably damaging	0.96
R1920:Kmt2d	UTSW	15	98855591	missense	probably damaging	1.00
R1956:Kmt2d	UTSW	15	98859590	unclassified	probably benign
R2100:Kmt2d	UTSW	15	98846480	unclassified	probably benign
R2120:Kmt2d	UTSW	15	98839529	unclassified	probably benign
R2188:Kmt2d	UTSW	15	98839300	unclassified	probably benign
R2191:Kmt2d	UTSW	15	98861049	critical splice donor site	probably null
R2234:Kmt2d	UTSW	15	98865248	missense	probably damaging	0.98
R2422:Kmt2d	UTSW	15	98862266	missense	unknown
R2762:Kmt2d	UTSW	15	98852055	unclassified	probably benign
R2895:Kmt2d	UTSW	15	98843939	unclassified	probably benign
R3624:Kmt2d	UTSW	15	98842902	unclassified	probably benign
R3791:Kmt2d	UTSW	15	98844149	unclassified	probably benign
R3794:Kmt2d	UTSW	15	98837359	unclassified	probably benign
R3871:Kmt2d	UTSW	15	98851021	unclassified	probably benign
R3958:Kmt2d	UTSW	15	98855549	missense	possibly damaging	0.69
R3983:Kmt2d	UTSW	15	98846046	unclassified	probably benign
R4211:Kmt2d	UTSW	15	98840189	unclassified	probably benign
R4240:Kmt2d	UTSW	15	98844571	unclassified	probably benign
R4246:Kmt2d	UTSW	15	98840089	unclassified	probably benign
R4361:Kmt2d	UTSW	15	98863670	missense	unknown
R4388:Kmt2d	UTSW	15	98853626	unclassified	probably benign
R4602:Kmt2d	UTSW	15	98850259	unclassified	probably benign
R4606:Kmt2d	UTSW	15	98839716	unclassified	probably benign
R4658:Kmt2d	UTSW	15	98852529	unclassified	probably benign
R4840:Kmt2d	UTSW	15	98861894	missense	unknown
R4895:Kmt2d	UTSW	15	98844487	unclassified	probably benign
R4906:Kmt2d	UTSW	15	98849539	unclassified	probably benign
R4976:Kmt2d	UTSW	15	98847194	utr 3 prime	probably benign
R5093:Kmt2d	UTSW	15	98856162	missense	probably damaging	1.00
R5119:Kmt2d	UTSW	15	98847194	utr 3 prime	probably benign
R5160:Kmt2d	UTSW	15	98840224	unclassified	probably benign
R5260:Kmt2d	UTSW	15	98842860	unclassified	probably benign
R5274:Kmt2d	UTSW	15	98854230	unclassified	probably benign
R5450:Kmt2d	UTSW	15	98855086	missense	probably damaging	1.00
R5461:Kmt2d	UTSW	15	98852109	unclassified	probably benign
R5462:Kmt2d	UTSW	15	98852109	unclassified	probably benign
R5463:Kmt2d	UTSW	15	98852109	unclassified	probably benign
R5465:Kmt2d	UTSW	15	98852109	unclassified	probably benign
R5467:Kmt2d	UTSW	15	98852109	unclassified	probably benign
R5481:Kmt2d	UTSW	15	98862005	missense	unknown
R5509:Kmt2d	UTSW	15	98839676	unclassified	probably benign
R5534:Kmt2d	UTSW	15	98837357	unclassified	probably benign
R5536:Kmt2d	UTSW	15	98852109	unclassified	probably benign
R5537:Kmt2d	UTSW	15	98852109	unclassified	probably benign
R5538:Kmt2d	UTSW	15	98852109	unclassified	probably benign
R5546:Kmt2d	UTSW	15	98853068	unclassified	probably benign
R5595:Kmt2d	UTSW	15	98850024	unclassified	probably benign
R5645:Kmt2d	UTSW	15	98844397	unclassified	probably benign
R5679:Kmt2d	UTSW	15	98854272	unclassified	probably benign
R5710:Kmt2d	UTSW	15	98854106	unclassified	probably benign
R5755:Kmt2d	UTSW	15	98863646	missense	unknown
R5817:Kmt2d	UTSW	15	98862363	missense	unknown
R5841:Kmt2d	UTSW	15	98852109	unclassified	probably benign
R5842:Kmt2d	UTSW	15	98852109	unclassified	probably benign
R5843:Kmt2d	UTSW	15	98852109	unclassified	probably benign
R5844:Kmt2d	UTSW	15	98852109	unclassified	probably benign
R5845:Kmt2d	UTSW	15	98852109	unclassified	probably benign
R6122:Kmt2d	UTSW	15	98860692	unclassified	probably benign
R6612:Kmt2d	UTSW	15	98845858	unclassified	probably benign
R6718:Kmt2d	UTSW	15	98849586	unclassified	probably benign
R6718:Kmt2d	UTSW	15	98850539	unclassified	probably benign
R6822:Kmt2d	UTSW	15	98849459	unclassified	probably benign
R6866:Kmt2d	UTSW	15	98857393	unclassified	probably benign
R6950:Kmt2d	UTSW	15	98840020	unclassified	probably benign
R7089:Kmt2d	UTSW	15	98850272	missense	unknown
R7120:Kmt2d	UTSW	15	98861065	missense	unknown
R7131:Kmt2d	UTSW	15	98849616	unclassified	probably benign
R7177:Kmt2d	UTSW	15	98850386	missense	unknown
R7194:Kmt2d	UTSW	15	98843833	missense	unknown
R7252:Kmt2d	UTSW	15	98844266	missense	unknown
R7282:Kmt2d	UTSW	15	98854104	missense	unknown
R7307:Kmt2d	UTSW	15	98849418	missense	unknown
R7313:Kmt2d	UTSW	15	98856623	missense	unknown
R7394:Kmt2d	UTSW	15	98856384	missense	unknown
R7404:Kmt2d	UTSW	15	98845495	missense	unknown
R7409:Kmt2d	UTSW	15	98855354	missense	probably damaging	1.00
R7414:Kmt2d	UTSW	15	98839856	missense	unknown
R7534:Kmt2d	UTSW	15	98852018	missense	unknown
R7575:Kmt2d	UTSW	15	98849611	unclassified	probably benign
R7650:Kmt2d	UTSW	15	98850870	missense	unknown
R7687:Kmt2d	UTSW	15	98862120	missense	unknown
R7699:Kmt2d	UTSW	15	98843719	missense	unknown
R7700:Kmt2d	UTSW	15	98843719	missense	unknown
R7765:Kmt2d	UTSW	15	98852334	missense	unknown
R7797:Kmt2d	UTSW	15	98864406	missense	probably benign	0.24
R7803:Kmt2d	UTSW	15	98862923	missense	unknown
R7952:Kmt2d	UTSW	15	98850768	missense	unknown
R8054:Kmt2d	UTSW	15	98843925	missense	unknown
R8084:Kmt2d	UTSW	15	98842064	missense	unknown
R8089:Kmt2d	UTSW	15	98842869	missense	unknown
R8133:Kmt2d	UTSW	15	98864942	missense	probably damaging	1.00
R8138:Kmt2d	UTSW	15	98843653	missense	unknown
R8343:Kmt2d	UTSW	15	98852597	missense	unknown
R8681:Kmt2d	UTSW	15	98846067	missense	unknown
R8694:Kmt2d	UTSW	15	98844734	missense	unknown
R8837:Kmt2d	UTSW	15	98864167	missense	unknown
R8855:Kmt2d	UTSW	15	98856356	missense	unknown
R8934:Kmt2d	UTSW	15	98861886	missense	unknown
R9100:Kmt2d	UTSW	15	98849951	missense	unknown
R9158:Kmt2d	UTSW	15	98843139	missense	unknown
R9190:Kmt2d	UTSW	15	98852015	missense	unknown
R9222:Kmt2d	UTSW	15	98849443	missense	unknown
R9263:Kmt2d	UTSW	15	98849618	frame shift	probably null
R9336:Kmt2d	UTSW	15	98845816	missense	unknown
R9397:Kmt2d	UTSW	15	98850113	missense	unknown
R9415:Kmt2d	UTSW	15	98839705	missense	unknown
R9482:Kmt2d	UTSW	15	98865165	missense	probably damaging	1.00
R9529:Kmt2d	UTSW	15	98839768	missense	unknown
R9610:Kmt2d	UTSW	15	98845176	unclassified	probably benign
R9611:Kmt2d	UTSW	15	98845173	unclassified	probably benign
R9611:Kmt2d	UTSW	15	98845176	unclassified	probably benign
R9612:Kmt2d	UTSW	15	98845176	unclassified	probably benign
R9613:Kmt2d	UTSW	15	98845176	unclassified	probably benign
R9644:Kmt2d	UTSW	15	98845504	missense	unknown
R9716:Kmt2d	UTSW	15	98843402	missense	unknown
R9763:Kmt2d	UTSW	15	98845176	unclassified	probably benign
R9782:Kmt2d	UTSW	15	98866716	missense	probably damaging	1.00
X0018:Kmt2d	UTSW	15	98852922	unclassified	probably benign
X0024:Kmt2d	UTSW	15	98853053	unclassified	probably benign
X0062:Kmt2d	UTSW	15	98849819	unclassified	probably benign
Z1187:Kmt2d	UTSW	15	98851744	missense	unknown
Z1188:Kmt2d	UTSW	15	98851744	missense	unknown
Z1189:Kmt2d	UTSW	15	98851744	missense	unknown
Z1190:Kmt2d	UTSW	15	98851744	missense	unknown
Z1192:Kmt2d	UTSW	15	98851744	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TGAAGCAAGTTCACCTGGG -3'
(R):5'- GGGCCTCTTGAACCAGAATC -3'

Sequencing Primer
(F):5'- AAGTTCACCTGGGGCTGG -3'
(R):5'- GAACTTTATTATCTCCGCAGCAGCAG -3'

Posted On

2015-06-10