Incidental Mutation 'R4212:Olfr173'
ID319276
Institutional Source Beutler Lab
Gene Symbol Olfr173
Ensembl Gene ENSMUSG00000049362
Gene Nameolfactory receptor 173
SynonymsMOR184-3, GA_x54KRFPKG5P-54960233-54959268
MMRRC Submission 041641-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R4212 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location58795207-58800268 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58797369 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 159 (H159L)
Ref Sequence ENSEMBL: ENSMUSP00000145946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049940] [ENSMUST00000206205]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049940
AA Change: H159L

PolyPhen 2 Score 0.672 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000052798
Gene: ENSMUSG00000049362
AA Change: H159L

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.7e-52 PFAM
Pfam:7tm_1 41 290 9.7e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000206205
AA Change: H159L

PolyPhen 2 Score 0.672 (Sensitivity: 0.86; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik C T 13: 58,381,991 G269E probably damaging Het
A1bg G T 15: 60,919,736 L284M possibly damaging Het
Adamts15 A G 9: 30,906,174 V536A probably damaging Het
AI464131 T C 4: 41,498,307 E441G probably benign Het
Arsi A T 18: 60,916,701 I219F probably damaging Het
Atg7 G A 6: 114,703,425 G447E probably benign Het
Bdp1 T A 13: 100,059,585 H1223L probably benign Het
Cep152 A G 2: 125,620,001 M87T probably benign Het
Chrm3 T C 13: 9,877,755 D415G probably benign Het
Chrnb2 A T 3: 89,761,544 C155S probably damaging Het
Col6a4 T A 9: 106,075,370 Q443L probably benign Het
D5Ertd579e A T 5: 36,614,479 D857E probably damaging Het
Efcab6 T C 15: 83,892,863 D1124G probably damaging Het
F830045P16Rik C T 2: 129,460,353 A440T probably benign Het
Gc T C 5: 89,435,575 K370E probably benign Het
Gm11559 A G 11: 99,864,900 Q125R unknown Het
Gm3985 A T 8: 32,942,456 noncoding transcript Het
Gm648 C T X: 56,545,208 V78I probably benign Het
Gm8765 C T 13: 50,700,352 T82I possibly damaging Het
Gucy2e A G 11: 69,228,123 F681S probably damaging Het
Hip1r A G 5: 123,999,890 I760V probably benign Het
Islr2 C T 9: 58,199,320 G219D probably damaging Het
Itgae A G 11: 73,119,352 H556R probably benign Het
Jag1 T C 2: 137,085,070 D923G probably benign Het
Kmt2c A G 5: 25,347,359 probably null Het
Kmt2d A G 15: 98,845,003 probably benign Het
Krtap17-1 A G 11: 99,993,914 L9P unknown Het
Lats2 C T 14: 57,696,255 D802N possibly damaging Het
Lrfn5 A T 12: 61,843,820 T632S probably benign Het
Myo9a C T 9: 59,906,066 R2183* probably null Het
Naip1 T C 13: 100,426,875 probably null Het
Nf1 T A 11: 79,469,798 V1434E probably damaging Het
Nlrc4 T C 17: 74,447,115 Y91C possibly damaging Het
Olfr1454 T G 19: 13,063,759 M116R probably damaging Het
Olfr723 A T 14: 49,928,889 Y218* probably null Het
Pard3 T A 8: 127,610,458 I1143K probably benign Het
Pcdha7 A G 18: 36,974,974 T351A probably benign Het
Phf2 C A 13: 48,820,613 G318V unknown Het
Plch1 T A 3: 63,870,759 probably benign Het
Polr1c A G 17: 46,246,120 I79T probably damaging Het
Ppp2r5e A G 12: 75,469,551 I244T probably damaging Het
Psmd12 T C 11: 107,485,759 C74R probably damaging Het
Ralgapa1 A G 12: 55,739,330 probably null Het
Robo3 C T 9: 37,421,898 G781D probably damaging Het
Scn8a T C 15: 100,957,073 V147A possibly damaging Het
Sema3b C T 9: 107,603,398 V117M probably damaging Het
Sfxn5 A T 6: 85,332,306 L139* probably null Het
Slc2a12 A T 10: 22,702,094 K596N probably benign Het
Sorcs1 G A 19: 50,225,175 R705C probably damaging Het
Tlr4 T A 4: 66,840,326 I452N probably damaging Het
Tshz3 A G 7: 36,770,119 D511G probably damaging Het
Usp44 A G 10: 93,846,770 K314E possibly damaging Het
Other mutations in Olfr173
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02649:Olfr173 APN 16 58797350 missense probably damaging 1.00
IGL02728:Olfr173 APN 16 58797480 missense probably benign 0.07
IGL02893:Olfr173 APN 16 58797657 missense probably damaging 1.00
R0035:Olfr173 UTSW 16 58797122 nonsense probably null
R0480:Olfr173 UTSW 16 58797321 missense probably benign 0.05
R1101:Olfr173 UTSW 16 58797252 missense probably benign 0.27
R1434:Olfr173 UTSW 16 58797448 missense probably benign 0.06
R1992:Olfr173 UTSW 16 58796946 missense probably benign
R2220:Olfr173 UTSW 16 58797624 missense possibly damaging 0.69
R2436:Olfr173 UTSW 16 58797244 missense probably benign 0.00
R4910:Olfr173 UTSW 16 58797442 missense probably benign 0.03
R5666:Olfr173 UTSW 16 58797061 missense possibly damaging 0.75
R5670:Olfr173 UTSW 16 58797061 missense possibly damaging 0.75
R5896:Olfr173 UTSW 16 58797732 missense probably damaging 1.00
R6182:Olfr173 UTSW 16 58797292 missense probably damaging 1.00
R6613:Olfr173 UTSW 16 58797531 missense probably damaging 0.99
R6723:Olfr173 UTSW 16 58797432 missense probably benign 0.06
R7051:Olfr173 UTSW 16 58797175 missense probably benign 0.21
R7141:Olfr173 UTSW 16 58797408 missense probably benign 0.05
R7179:Olfr173 UTSW 16 58796887 missense probably benign 0.00
R7602:Olfr173 UTSW 16 58796980 missense possibly damaging 0.62
Z1176:Olfr173 UTSW 16 58797423 missense probably damaging 1.00
Z1176:Olfr173 UTSW 16 58797673 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGTGGAGAAGGCTTTGATCC -3'
(R):5'- CTGTGCACTGTTGAAACTGC -3'

Sequencing Primer
(F):5'- AAGGCTTTGATCCTTCCCTC -3'
(R):5'- CTGTTGAAACTGCAGACTGC -3'
Posted On2015-06-10