Incidental Mutation 'R4212:Pcdha7'
ID319279
Institutional Source Beutler Lab
Gene Symbol Pcdha7
Ensembl Gene ENSMUSG00000104318
Gene Nameprotocadherin alpha 7
SynonymsCnr4, Crnr4
MMRRC Submission 041641-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R4212 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location36973802-37187657 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36974974 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 351 (T351A)
Ref Sequence ENSEMBL: ENSMUSP00000142156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070797] [ENSMUST00000115661] [ENSMUST00000115662] [ENSMUST00000192168] [ENSMUST00000192295] [ENSMUST00000192503] [ENSMUST00000192512] [ENSMUST00000192631] [ENSMUST00000193389] [ENSMUST00000193777] [ENSMUST00000193839] [ENSMUST00000194544] [ENSMUST00000194751] [ENSMUST00000195590]
Predicted Effect probably benign
Transcript: ENSMUST00000070797
SMART Domains Protein: ENSMUSP00000068828
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Pfam:Cadherin_tail 797 931 5.3e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115662
SMART Domains Protein: ENSMUSP00000111326
Gene: ENSMUSG00000104148

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 916 940 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192168
SMART Domains Protein: ENSMUSP00000142293
Gene: ENSMUSG00000103092

DomainStartEndE-ValueType
CA 21 131 2.2e-2 SMART
CA 155 240 2.05e-21 SMART
CA 264 348 8.81e-21 SMART
CA 372 453 2.01e-24 SMART
CA 477 563 1.42e-24 SMART
CA 591 673 1.63e-15 SMART
transmembrane domain 693 715 N/A INTRINSIC
low complexity region 902 926 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192295
SMART Domains Protein: ENSMUSP00000142103
Gene: ENSMUSG00000104252

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 568 5.38e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192503
SMART Domains Protein: ENSMUSP00000141989
Gene: ENSMUSG00000102312

DomainStartEndE-ValueType
low complexity region 11 17 N/A INTRINSIC
CA 42 128 3.78e-2 SMART
CA 152 237 8.94e-22 SMART
CA 261 345 3.74e-24 SMART
CA 369 450 1.09e-25 SMART
CA 474 560 1.42e-24 SMART
CA 588 670 2.96e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 910 934 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192512
SMART Domains Protein: ENSMUSP00000141408
Gene: ENSMUSG00000104252

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
low complexity region 915 939 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192631
AA Change: T351A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000142156
Gene: ENSMUSG00000104318
AA Change: T351A

DomainStartEndE-ValueType
CA 21 131 2.58e-2 SMART
CA 155 240 4.27e-19 SMART
CA 264 348 1.42e-24 SMART
CA 372 453 9.36e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 671 4.03e-6 SMART
transmembrane domain 696 718 N/A INTRINSIC
low complexity region 905 929 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193389
SMART Domains Protein: ENSMUSP00000141459
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
CA 21 131 5.67e-2 SMART
CA 155 240 4.72e-21 SMART
CA 264 348 1.9e-25 SMART
CA 372 453 3.31e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 676 5.91e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193777
SMART Domains Protein: ENSMUSP00000141587
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
CA 21 131 5.67e-2 SMART
CA 155 240 4.72e-21 SMART
CA 264 348 1.9e-25 SMART
CA 372 453 3.31e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 676 5.91e-13 SMART
low complexity region 914 938 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193839
SMART Domains Protein: ENSMUSP00000142308
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000194751
SMART Domains Protein: ENSMUSP00000142285
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
Pfam:Cadherin_2 29 112 4.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195590
SMART Domains Protein: ENSMUSP00000141355
Gene: ENSMUSG00000104148

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin alpha gene cluster, one of three related gene clusters tandemly linked on chromosome five that demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The alpha gene cluster is composed of 15 cadherin superfamily genes related to the mouse CNR genes and consists of 13 highly similar and 2 more distantly related coding sequences. The tandem array of 15 N-terminal exons, or variable exons, are followed by downstream C-terminal exons, or constant exons, which are shared by all genes in the cluster. The large, uninterrupted N-terminal exons each encode six cadherin ectodomains while the C-terminal exons encode the cytoplasmic domain. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been observed and additional variants have been suggested but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik C T 13: 58,381,991 G269E probably damaging Het
A1bg G T 15: 60,919,736 L284M possibly damaging Het
Adamts15 A G 9: 30,906,174 V536A probably damaging Het
AI464131 T C 4: 41,498,307 E441G probably benign Het
Arsi A T 18: 60,916,701 I219F probably damaging Het
Atg7 G A 6: 114,703,425 G447E probably benign Het
Bdp1 T A 13: 100,059,585 H1223L probably benign Het
Cep152 A G 2: 125,620,001 M87T probably benign Het
Chrm3 T C 13: 9,877,755 D415G probably benign Het
Chrnb2 A T 3: 89,761,544 C155S probably damaging Het
Col6a4 T A 9: 106,075,370 Q443L probably benign Het
D5Ertd579e A T 5: 36,614,479 D857E probably damaging Het
Efcab6 T C 15: 83,892,863 D1124G probably damaging Het
F830045P16Rik C T 2: 129,460,353 A440T probably benign Het
Gc T C 5: 89,435,575 K370E probably benign Het
Gm11559 A G 11: 99,864,900 Q125R unknown Het
Gm3985 A T 8: 32,942,456 noncoding transcript Het
Gm648 C T X: 56,545,208 V78I probably benign Het
Gm8765 C T 13: 50,700,352 T82I possibly damaging Het
Gucy2e A G 11: 69,228,123 F681S probably damaging Het
Hip1r A G 5: 123,999,890 I760V probably benign Het
Islr2 C T 9: 58,199,320 G219D probably damaging Het
Itgae A G 11: 73,119,352 H556R probably benign Het
Jag1 T C 2: 137,085,070 D923G probably benign Het
Kmt2c A G 5: 25,347,359 probably null Het
Kmt2d A G 15: 98,845,003 probably benign Het
Krtap17-1 A G 11: 99,993,914 L9P unknown Het
Lats2 C T 14: 57,696,255 D802N possibly damaging Het
Lrfn5 A T 12: 61,843,820 T632S probably benign Het
Myo9a C T 9: 59,906,066 R2183* probably null Het
Naip1 T C 13: 100,426,875 probably null Het
Nf1 T A 11: 79,469,798 V1434E probably damaging Het
Nlrc4 T C 17: 74,447,115 Y91C possibly damaging Het
Olfr1454 T G 19: 13,063,759 M116R probably damaging Het
Olfr173 T A 16: 58,797,369 H159L possibly damaging Het
Olfr723 A T 14: 49,928,889 Y218* probably null Het
Pard3 T A 8: 127,610,458 I1143K probably benign Het
Phf2 C A 13: 48,820,613 G318V unknown Het
Plch1 T A 3: 63,870,759 probably benign Het
Polr1c A G 17: 46,246,120 I79T probably damaging Het
Ppp2r5e A G 12: 75,469,551 I244T probably damaging Het
Psmd12 T C 11: 107,485,759 C74R probably damaging Het
Ralgapa1 A G 12: 55,739,330 probably null Het
Robo3 C T 9: 37,421,898 G781D probably damaging Het
Scn8a T C 15: 100,957,073 V147A possibly damaging Het
Sema3b C T 9: 107,603,398 V117M probably damaging Het
Sfxn5 A T 6: 85,332,306 L139* probably null Het
Slc2a12 A T 10: 22,702,094 K596N probably benign Het
Sorcs1 G A 19: 50,225,175 R705C probably damaging Het
Tlr4 T A 4: 66,840,326 I452N probably damaging Het
Tshz3 A G 7: 36,770,119 D511G probably damaging Het
Usp44 A G 10: 93,846,770 K314E possibly damaging Het
Other mutations in Pcdha7
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2511:Pcdha7 UTSW 18 36974733 missense probably damaging 1.00
R3881:Pcdha7 UTSW 18 36975379 missense probably benign 0.44
R4533:Pcdha7 UTSW 18 36975407 missense possibly damaging 0.73
R4608:Pcdha7 UTSW 18 36975817 missense possibly damaging 0.85
R4766:Pcdha7 UTSW 18 36974507 missense probably damaging 0.99
R4808:Pcdha7 UTSW 18 36974228 missense probably damaging 1.00
R4897:Pcdha7 UTSW 18 36975593 missense probably damaging 1.00
R5030:Pcdha7 UTSW 18 36975448 missense probably damaging 1.00
R5173:Pcdha7 UTSW 18 36974652 missense probably benign 0.03
R5333:Pcdha7 UTSW 18 36974566 missense probably benign 0.14
R5342:Pcdha7 UTSW 18 36974671 missense possibly damaging 0.74
R5463:Pcdha7 UTSW 18 36975575 missense probably damaging 1.00
R5536:Pcdha7 UTSW 18 36975250 missense probably damaging 1.00
R5848:Pcdha7 UTSW 18 36975083 missense probably damaging 1.00
R5858:Pcdha7 UTSW 18 36976226 missense probably damaging 0.99
R5887:Pcdha7 UTSW 18 36975907 missense probably damaging 0.96
R6115:Pcdha7 UTSW 18 36974735 missense probably damaging 0.99
R6496:Pcdha7 UTSW 18 36974585 missense possibly damaging 0.86
R6522:Pcdha7 UTSW 18 36973942 missense possibly damaging 0.74
R6653:Pcdha7 UTSW 18 36974486 missense probably benign 0.01
R6815:Pcdha7 UTSW 18 36975121 missense probably damaging 0.99
R7313:Pcdha7 UTSW 18 36974418 missense probably damaging 1.00
R7519:Pcdha7 UTSW 18 36976232 missense possibly damaging 0.93
R7520:Pcdha7 UTSW 18 36975313 missense probably damaging 0.99
R7857:Pcdha7 UTSW 18 36975839 missense probably damaging 0.99
R7939:Pcdha7 UTSW 18 36976010 missense possibly damaging 0.68
R8229:Pcdha7 UTSW 18 36974723 nonsense probably null
Z1176:Pcdha7 UTSW 18 36975840 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TCCAAGTTCCACATGGACACTG -3'
(R):5'- CAATCACATCATAGTTAGCGATGG -3'

Sequencing Primer
(F):5'- CACTGTGAGTGGAGAGATTACAG -3'
(R):5'- ACATCATAGTTAGCGATGGTCTCTCG -3'
Posted On2015-06-10