Incidental Mutation 'R4212:Arsi'
ID319280
Institutional Source Beutler Lab
Gene Symbol Arsi
Ensembl Gene ENSMUSG00000036412
Gene Namearylsulfatase i
Synonyms
MMRRC Submission 041641-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R4212 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location60911780-60918561 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 60916701 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 219 (I219F)
Ref Sequence ENSEMBL: ENSMUSP00000043966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040359]
Predicted Effect probably damaging
Transcript: ENSMUST00000040359
AA Change: I219F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000043966
Gene: ENSMUSG00000036412
AA Change: I219F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Sulfatase 47 360 8.2e-73 PFAM
low complexity region 526 537 N/A INTRINSIC
low complexity region 547 556 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a large family of sulfatases that hydrolyze sulfate esters and sulfamates. Members of this family play a role in several cellular processes, including hormone synthesis, cell signaling in development and degradation of macromolecules. The protein encoded by this gene is thought to be secreted, and to function in extracellular space. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik C T 13: 58,381,991 G269E probably damaging Het
A1bg G T 15: 60,919,736 L284M possibly damaging Het
Adamts15 A G 9: 30,906,174 V536A probably damaging Het
AI464131 T C 4: 41,498,307 E441G probably benign Het
Atg7 G A 6: 114,703,425 G447E probably benign Het
Bdp1 T A 13: 100,059,585 H1223L probably benign Het
Cep152 A G 2: 125,620,001 M87T probably benign Het
Chrm3 T C 13: 9,877,755 D415G probably benign Het
Chrnb2 A T 3: 89,761,544 C155S probably damaging Het
Col6a4 T A 9: 106,075,370 Q443L probably benign Het
D5Ertd579e A T 5: 36,614,479 D857E probably damaging Het
Efcab6 T C 15: 83,892,863 D1124G probably damaging Het
F830045P16Rik C T 2: 129,460,353 A440T probably benign Het
Gc T C 5: 89,435,575 K370E probably benign Het
Gm11559 A G 11: 99,864,900 Q125R unknown Het
Gm3985 A T 8: 32,942,456 noncoding transcript Het
Gm648 C T X: 56,545,208 V78I probably benign Het
Gm8765 C T 13: 50,700,352 T82I possibly damaging Het
Gucy2e A G 11: 69,228,123 F681S probably damaging Het
Hip1r A G 5: 123,999,890 I760V probably benign Het
Islr2 C T 9: 58,199,320 G219D probably damaging Het
Itgae A G 11: 73,119,352 H556R probably benign Het
Jag1 T C 2: 137,085,070 D923G probably benign Het
Kmt2c A G 5: 25,347,359 probably null Het
Kmt2d A G 15: 98,845,003 probably benign Het
Krtap17-1 A G 11: 99,993,914 L9P unknown Het
Lats2 C T 14: 57,696,255 D802N possibly damaging Het
Lrfn5 A T 12: 61,843,820 T632S probably benign Het
Myo9a C T 9: 59,906,066 R2183* probably null Het
Naip1 T C 13: 100,426,875 probably null Het
Nf1 T A 11: 79,469,798 V1434E probably damaging Het
Nlrc4 T C 17: 74,447,115 Y91C possibly damaging Het
Olfr1454 T G 19: 13,063,759 M116R probably damaging Het
Olfr173 T A 16: 58,797,369 H159L possibly damaging Het
Olfr723 A T 14: 49,928,889 Y218* probably null Het
Pard3 T A 8: 127,610,458 I1143K probably benign Het
Pcdha7 A G 18: 36,974,974 T351A probably benign Het
Phf2 C A 13: 48,820,613 G318V unknown Het
Plch1 T A 3: 63,870,759 probably benign Het
Polr1c A G 17: 46,246,120 I79T probably damaging Het
Ppp2r5e A G 12: 75,469,551 I244T probably damaging Het
Psmd12 T C 11: 107,485,759 C74R probably damaging Het
Ralgapa1 A G 12: 55,739,330 probably null Het
Robo3 C T 9: 37,421,898 G781D probably damaging Het
Scn8a T C 15: 100,957,073 V147A possibly damaging Het
Sema3b C T 9: 107,603,398 V117M probably damaging Het
Sfxn5 A T 6: 85,332,306 L139* probably null Het
Slc2a12 A T 10: 22,702,094 K596N probably benign Het
Sorcs1 G A 19: 50,225,175 R705C probably damaging Het
Tlr4 T A 4: 66,840,326 I452N probably damaging Het
Tshz3 A G 7: 36,770,119 D511G probably damaging Het
Usp44 A G 10: 93,846,770 K314E possibly damaging Het
Other mutations in Arsi
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Arsi APN 18 60912430 missense probably damaging 1.00
IGL02519:Arsi APN 18 60917067 missense probably damaging 1.00
IGL03186:Arsi APN 18 60917473 missense probably damaging 1.00
IGL03134:Arsi UTSW 18 60917352 missense probably damaging 1.00
R0003:Arsi UTSW 18 60916986 missense probably benign 0.29
R0003:Arsi UTSW 18 60916986 missense probably benign 0.29
R0448:Arsi UTSW 18 60917302 missense probably damaging 0.98
R1147:Arsi UTSW 18 60916651 missense probably benign 0.07
R1147:Arsi UTSW 18 60916651 missense probably benign 0.07
R1148:Arsi UTSW 18 60916651 missense probably benign 0.07
R1148:Arsi UTSW 18 60916651 missense probably benign 0.07
R1190:Arsi UTSW 18 60916651 missense probably benign 0.07
R1261:Arsi UTSW 18 60916671 missense probably damaging 1.00
R1511:Arsi UTSW 18 60916651 missense probably benign 0.07
R1538:Arsi UTSW 18 60916651 missense probably benign 0.07
R1635:Arsi UTSW 18 60916651 missense probably benign 0.07
R1641:Arsi UTSW 18 60916651 missense probably benign 0.07
R1759:Arsi UTSW 18 60916651 missense probably benign 0.07
R1794:Arsi UTSW 18 60916651 missense probably benign 0.07
R1822:Arsi UTSW 18 60916651 missense probably benign 0.07
R1824:Arsi UTSW 18 60912297 missense probably damaging 1.00
R1824:Arsi UTSW 18 60916651 missense probably benign 0.07
R1930:Arsi UTSW 18 60916651 missense probably benign 0.07
R1932:Arsi UTSW 18 60916651 missense probably benign 0.07
R1983:Arsi UTSW 18 60916651 missense probably benign 0.07
R2035:Arsi UTSW 18 60916651 missense probably benign 0.07
R2036:Arsi UTSW 18 60916651 missense probably benign 0.07
R2108:Arsi UTSW 18 60916371 missense possibly damaging 0.75
R2166:Arsi UTSW 18 60916651 missense probably benign 0.07
R2168:Arsi UTSW 18 60916651 missense probably benign 0.07
R2261:Arsi UTSW 18 60916665 missense probably damaging 1.00
R2263:Arsi UTSW 18 60916665 missense probably damaging 1.00
R2299:Arsi UTSW 18 60916651 missense probably benign 0.07
R2300:Arsi UTSW 18 60916651 missense probably benign 0.07
R2393:Arsi UTSW 18 60916651 missense probably benign 0.07
R2402:Arsi UTSW 18 60916467 missense possibly damaging 0.88
R2484:Arsi UTSW 18 60916651 missense probably benign 0.07
R2511:Arsi UTSW 18 60916594 missense probably damaging 1.00
R2994:Arsi UTSW 18 60916651 missense probably benign 0.07
R2995:Arsi UTSW 18 60916651 missense probably benign 0.07
R2996:Arsi UTSW 18 60916651 missense probably benign 0.07
R2997:Arsi UTSW 18 60916651 missense probably benign 0.07
R3625:Arsi UTSW 18 60916651 missense probably benign 0.07
R3694:Arsi UTSW 18 60916651 missense probably benign 0.07
R3695:Arsi UTSW 18 60916651 missense probably benign 0.07
R3883:Arsi UTSW 18 60916651 missense probably benign 0.07
R3884:Arsi UTSW 18 60916651 missense probably benign 0.07
R3907:Arsi UTSW 18 60916651 missense probably benign 0.07
R3932:Arsi UTSW 18 60916651 missense probably benign 0.07
R3954:Arsi UTSW 18 60916651 missense probably benign 0.07
R4256:Arsi UTSW 18 60917316 missense probably damaging 1.00
R4257:Arsi UTSW 18 60916651 missense probably benign 0.07
R4258:Arsi UTSW 18 60917316 missense probably damaging 1.00
R4459:Arsi UTSW 18 60916651 missense probably benign 0.07
R4469:Arsi UTSW 18 60916651 missense probably benign 0.07
R4601:Arsi UTSW 18 60916651 missense probably benign 0.07
R4603:Arsi UTSW 18 60916651 missense probably benign 0.07
R4610:Arsi UTSW 18 60916651 missense probably benign 0.07
R4649:Arsi UTSW 18 60916651 missense probably benign 0.07
R4649:Arsi UTSW 18 60917098 missense probably damaging 1.00
R4650:Arsi UTSW 18 60916651 missense probably benign 0.07
R4651:Arsi UTSW 18 60916651 missense probably benign 0.07
R4652:Arsi UTSW 18 60916651 missense probably benign 0.07
R4749:Arsi UTSW 18 60917461 missense probably benign 0.23
R4766:Arsi UTSW 18 60916651 missense probably benign 0.07
R4807:Arsi UTSW 18 60916651 missense probably benign 0.07
R4808:Arsi UTSW 18 60916651 missense probably benign 0.07
R4856:Arsi UTSW 18 60916651 missense probably benign 0.07
R4860:Arsi UTSW 18 60916651 missense probably benign 0.07
R4860:Arsi UTSW 18 60916651 missense probably benign 0.07
R4886:Arsi UTSW 18 60916651 missense probably benign 0.07
R5015:Arsi UTSW 18 60916651 missense probably benign 0.07
R5121:Arsi UTSW 18 60917439 missense probably damaging 1.00
R5185:Arsi UTSW 18 60916912 missense probably damaging 1.00
R6191:Arsi UTSW 18 60912472 missense probably damaging 1.00
R6197:Arsi UTSW 18 60916651 missense probably benign 0.07
R6218:Arsi UTSW 18 60916651 missense probably benign 0.07
R6219:Arsi UTSW 18 60916651 missense probably benign 0.07
R6220:Arsi UTSW 18 60916651 missense probably benign 0.07
R6378:Arsi UTSW 18 60916501 missense probably damaging 1.00
R6612:Arsi UTSW 18 60912456 missense probably benign 0.12
R6871:Arsi UTSW 18 60916651 missense probably benign 0.07
R7813:Arsi UTSW 18 60916654 missense possibly damaging 0.58
R7974:Arsi UTSW 18 60912406 missense probably damaging 1.00
R8035:Arsi UTSW 18 60916370 missense probably damaging 1.00
Z1176:Arsi UTSW 18 60916780 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGGCATCTGGGCTTCTAC -3'
(R):5'- ATAGAAACCATAGCGCTTGAGG -3'

Sequencing Primer
(F):5'- AAGGAGTGCTTGCCTACCC -3'
(R):5'- CAGGTGATGTTACGCACAGC -3'
Posted On2015-06-10