Incidental Mutation 'R4213:Chml'
ID319286
Institutional Source Beutler Lab
Gene Symbol Chml
Ensembl Gene ENSMUSG00000078185
Gene Namechoroideremia-like
SynonymsE030003F13Rik, Rep2
MMRRC Submission 041040-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R4213 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location175682237-175692901 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 175686695 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 210 (F210L)
Ref Sequence ENSEMBL: ENSMUSP00000147761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027809] [ENSMUST00000104984] [ENSMUST00000209720] [ENSMUST00000210367] [ENSMUST00000211207] [ENSMUST00000211489]
Predicted Effect probably benign
Transcript: ENSMUST00000027809
SMART Domains Protein: ENSMUSP00000027809
Gene: ENSMUSG00000026525

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
Pfam:7tm_1 56 307 4.7e-36 PFAM
low complexity region 314 331 N/A INTRINSIC
low complexity region 363 375 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000104984
AA Change: F553L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100600
Gene: ENSMUSG00000078185
AA Change: F553L

DomainStartEndE-ValueType
Pfam:GDI 5 106 3.1e-14 PFAM
Pfam:GDI 200 534 1e-49 PFAM
low complexity region 598 618 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209720
Predicted Effect probably damaging
Transcript: ENSMUST00000210367
AA Change: F210L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000211207
AA Change: F553L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000211489
Meta Mutation Damage Score 0.1879 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of the CHML gene supports geranylgeranylation of most Rab proteins and may substitute for REP-1 in tissues other than retina. CHML is localized close to the gene for Usher syndrome type II. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik G A 3: 92,869,127 P83L probably benign Het
Ankrd11 A C 8: 122,891,026 V2029G probably benign Het
Arhgap28 A T 17: 67,871,993 V291E probably benign Het
Cad G A 5: 31,072,344 V1390I probably benign Het
Cadps2 A T 6: 23,599,463 D281E probably damaging Het
Celsr1 G A 15: 86,031,807 T655I probably damaging Het
Cep350 C G 1: 155,935,961 G411A probably damaging Het
Col4a4 A T 1: 82,453,144 M1679K unknown Het
Depdc1b T G 13: 108,388,691 F527V probably damaging Het
Dsg2 T C 18: 20,598,514 L731P probably benign Het
Fam69b C T 2: 26,635,948 T298I probably benign Het
Fbxo25 A G 8: 13,939,581 T343A probably damaging Het
Gk5 T C 9: 96,129,053 L72P probably damaging Het
Gm15448 C A 7: 3,821,554 A510S probably damaging Het
Gm648 C T X: 56,545,208 V78I probably benign Het
Gpr137c G A 14: 45,246,508 E231K probably damaging Het
Hdc C T 2: 126,597,866 probably null Het
Hydin A G 8: 110,456,507 N1112S possibly damaging Het
Itgae A G 11: 73,119,352 H556R probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Krtap17-1 A G 11: 99,993,914 L9P unknown Het
Nmur1 T G 1: 86,387,784 T87P probably damaging Het
Olfr1155 T C 2: 87,943,121 Y169C probably benign Het
Ppp2r5e A G 12: 75,469,551 I244T probably damaging Het
Robo3 C T 9: 37,421,898 G781D probably damaging Het
Siglec1 C T 2: 131,074,118 E1275K probably damaging Het
Slc2a12 A T 10: 22,702,094 K596N probably benign Het
Sorcs1 G A 19: 50,225,175 R705C probably damaging Het
Sqor G T 2: 122,787,498 G92V probably damaging Het
Tlr4 T A 4: 66,840,326 I452N probably damaging Het
Tob1 A G 11: 94,214,192 T185A probably damaging Het
Yjefn3 G T 8: 69,890,890 H50Q probably benign Het
Zswim1 T C 2: 164,825,785 V319A probably benign Het
Other mutations in Chml
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01576:Chml APN 1 175687705 missense probably benign 0.04
IGL01959:Chml APN 1 175687600 missense probably benign 0.30
IGL01981:Chml APN 1 175688185 missense probably damaging 0.98
IGL02321:Chml APN 1 175692334 missense possibly damaging 0.73
IGL03206:Chml APN 1 175687737 missense probably benign 0.00
R0323:Chml UTSW 1 175687084 missense probably benign 0.23
R0504:Chml UTSW 1 175687182 missense probably damaging 1.00
R0665:Chml UTSW 1 175687895 missense probably benign 0.01
R1770:Chml UTSW 1 175687878 missense probably benign 0.00
R1936:Chml UTSW 1 175687259 nonsense probably null
R3864:Chml UTSW 1 175688244 missense probably damaging 1.00
R4271:Chml UTSW 1 175687794 missense probably benign 0.16
R4576:Chml UTSW 1 175686940 missense probably damaging 0.97
R4609:Chml UTSW 1 175687157 nonsense probably null
R4649:Chml UTSW 1 175687396 missense probably benign 0.04
R4922:Chml UTSW 1 175687146 missense possibly damaging 0.89
R6007:Chml UTSW 1 175688028 missense probably benign 0.00
R6090:Chml UTSW 1 175687058 nonsense probably null
R6287:Chml UTSW 1 175687003 missense probably benign 0.01
R6558:Chml UTSW 1 175687182 missense probably damaging 1.00
R6944:Chml UTSW 1 175688161 missense probably damaging 0.99
R7555:Chml UTSW 1 175687890 missense probably benign 0.00
R7871:Chml UTSW 1 175687400 frame shift probably null
R8459:Chml UTSW 1 175688031 missense probably benign 0.01
X0013:Chml UTSW 1 175687116 missense probably benign 0.06
Z1176:Chml UTSW 1 175687762 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- AGCTTCAAAGATGATGTCTTCAGG -3'
(R):5'- CACTTCTGTTCGGGTCATGG -3'

Sequencing Primer
(F):5'- CAAAGATGATGTCTTCAGGGTTTG -3'
(R):5'- GGTCATGGAATTATGTTCGTCAACC -3'
Posted On2015-06-10