Incidental Mutation 'R4213:Fam69b'
ID319287
Institutional Source Beutler Lab
Gene Symbol Fam69b
Ensembl Gene ENSMUSG00000036186
Gene Namefamily with sequence similarity 69, member B
SynonymsB230317C12Rik, PIP49
MMRRC Submission 041040-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R4213 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location26628457-26636497 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 26635948 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 298 (T298I)
Ref Sequence ENSEMBL: ENSMUSP00000073860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074240] [ENSMUST00000174066]
Predicted Effect probably benign
Transcript: ENSMUST00000074240
AA Change: T298I

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000073860
Gene: ENSMUSG00000036186
AA Change: T298I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PIP49_N 22 180 2.18e-90 SMART
Pfam:PIP49_C 197 399 6.4e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104004
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131841
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144449
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153849
Predicted Effect probably benign
Transcript: ENSMUST00000174066
SMART Domains Protein: ENSMUSP00000133799
Gene: ENSMUSG00000092356

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 64 88 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181621
Meta Mutation Damage Score 0.0609 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the FAM69 family of cysteine-rich type II transmembrane proteins. These proteins localize to the endoplasmic reticulum but their specific functions are unknown. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik G A 3: 92,869,127 P83L probably benign Het
Ankrd11 A C 8: 122,891,026 V2029G probably benign Het
Arhgap28 A T 17: 67,871,993 V291E probably benign Het
Cad G A 5: 31,072,344 V1390I probably benign Het
Cadps2 A T 6: 23,599,463 D281E probably damaging Het
Celsr1 G A 15: 86,031,807 T655I probably damaging Het
Cep350 C G 1: 155,935,961 G411A probably damaging Het
Chml A T 1: 175,686,695 F210L probably damaging Het
Col4a4 A T 1: 82,453,144 M1679K unknown Het
Depdc1b T G 13: 108,388,691 F527V probably damaging Het
Dsg2 T C 18: 20,598,514 L731P probably benign Het
Fbxo25 A G 8: 13,939,581 T343A probably damaging Het
Gk5 T C 9: 96,129,053 L72P probably damaging Het
Gm15448 C A 7: 3,821,554 A510S probably damaging Het
Gm648 C T X: 56,545,208 V78I probably benign Het
Gpr137c G A 14: 45,246,508 E231K probably damaging Het
Hdc C T 2: 126,597,866 probably null Het
Hydin A G 8: 110,456,507 N1112S possibly damaging Het
Itgae A G 11: 73,119,352 H556R probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Krtap17-1 A G 11: 99,993,914 L9P unknown Het
Nmur1 T G 1: 86,387,784 T87P probably damaging Het
Olfr1155 T C 2: 87,943,121 Y169C probably benign Het
Ppp2r5e A G 12: 75,469,551 I244T probably damaging Het
Robo3 C T 9: 37,421,898 G781D probably damaging Het
Siglec1 C T 2: 131,074,118 E1275K probably damaging Het
Slc2a12 A T 10: 22,702,094 K596N probably benign Het
Sorcs1 G A 19: 50,225,175 R705C probably damaging Het
Sqor G T 2: 122,787,498 G92V probably damaging Het
Tlr4 T A 4: 66,840,326 I452N probably damaging Het
Tob1 A G 11: 94,214,192 T185A probably damaging Het
Yjefn3 G T 8: 69,890,890 H50Q probably benign Het
Zswim1 T C 2: 164,825,785 V319A probably benign Het
Other mutations in Fam69b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01927:Fam69b APN 2 26636115 missense probably benign 0.00
R0669:Fam69b UTSW 2 26634866 missense probably benign 0.00
R1912:Fam69b UTSW 2 26632704 missense probably damaging 1.00
R2258:Fam69b UTSW 2 26635150 missense probably damaging 0.99
R2760:Fam69b UTSW 2 26635825 missense probably benign 0.00
R3712:Fam69b UTSW 2 26632638 missense possibly damaging 0.72
R3953:Fam69b UTSW 2 26635567 missense probably benign 0.44
R3956:Fam69b UTSW 2 26635567 missense probably benign 0.44
R4190:Fam69b UTSW 2 26636181 missense probably damaging 1.00
R5161:Fam69b UTSW 2 26636248 missense possibly damaging 0.92
R5618:Fam69b UTSW 2 26634875 missense probably damaging 0.99
R6198:Fam69b UTSW 2 26635698 missense probably damaging 0.96
R6769:Fam69b UTSW 2 26634863 missense probably benign 0.00
R6771:Fam69b UTSW 2 26634863 missense probably benign 0.00
R8934:Fam69b UTSW 2 26634854 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CTATCTTACTGAGGGCATCCC -3'
(R):5'- TTAGCAGCTCGCACACCTTG -3'

Sequencing Primer
(F):5'- CCTCATGGTTCCTGGCATGG -3'
(R):5'- ATGAGGTCACCCTTGCACTG -3'
Posted On2015-06-10