Incidental Mutation 'R4213:Olfr1155'
ID 319288
Institutional Source Beutler Lab
Gene Symbol Olfr1155
Ensembl Gene ENSMUSG00000075145
Gene Name olfactory receptor 1155
Synonyms GA_x6K02T2Q125-49426894-49425950, MOR174-10
MMRRC Submission 041040-MU
Accession Numbers

Genbank: NM_146643; MGI: 3030989
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock # R4213 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 87941645-87945137 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 87943121 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 169 (Y169C)
Ref Sequence ENSEMBL: ENSMUSP00000149428 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099843] [ENSMUST00000214641] [ENSMUST00000215903] [ENSMUST00000216191] [ENSMUST00000216726]
AlphaFold Q8VFR3
Predicted Effect probably benign
Transcript: ENSMUST00000099843
AA Change: Y169C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097431
Gene: ENSMUSG00000075145
AA Change: Y169C

DomainStartEndE-ValueType
Pfam:7tm_4 33 310 2.7e-44 PFAM
Pfam:7tm_1 43 292 5.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214641
AA Change: Y169C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000215903
AA Change: Y169C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000216191
Predicted Effect probably benign
Transcript: ENSMUST00000216726
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik G A 3: 92,869,127 P83L probably benign Het
Ankrd11 A C 8: 122,891,026 V2029G probably benign Het
Arhgap28 A T 17: 67,871,993 V291E probably benign Het
Cad G A 5: 31,072,344 V1390I probably benign Het
Cadps2 A T 6: 23,599,463 D281E probably damaging Het
Celsr1 G A 15: 86,031,807 T655I probably damaging Het
Cep350 C G 1: 155,935,961 G411A probably damaging Het
Chml A T 1: 175,686,695 F210L probably damaging Het
Col4a4 A T 1: 82,453,144 M1679K unknown Het
Depdc1b T G 13: 108,388,691 F527V probably damaging Het
Dsg2 T C 18: 20,598,514 L731P probably benign Het
Fam69b C T 2: 26,635,948 T298I probably benign Het
Fbxo25 A G 8: 13,939,581 T343A probably damaging Het
Gk5 T C 9: 96,129,053 L72P probably damaging Het
Gm15448 C A 7: 3,821,554 A510S probably damaging Het
Gm648 C T X: 56,545,208 V78I probably benign Het
Gpr137c G A 14: 45,246,508 E231K probably damaging Het
Hdc C T 2: 126,597,866 probably null Het
Hydin A G 8: 110,456,507 N1112S possibly damaging Het
Itgae A G 11: 73,119,352 H556R probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 74 probably benign Het
Krtap17-1 A G 11: 99,993,914 L9P unknown Het
Nmur1 T G 1: 86,387,784 T87P probably damaging Het
Ppp2r5e A G 12: 75,469,551 I244T probably damaging Het
Robo3 C T 9: 37,421,898 G781D probably damaging Het
Siglec1 C T 2: 131,074,118 E1275K probably damaging Het
Slc2a12 A T 10: 22,702,094 K596N probably benign Het
Sorcs1 G A 19: 50,225,175 R705C probably damaging Het
Sqor G T 2: 122,787,498 G92V probably damaging Het
Tlr4 T A 4: 66,840,326 I452N probably damaging Het
Tob1 A G 11: 94,214,192 T185A probably damaging Het
Yjefn3 G T 8: 69,890,890 H50Q probably benign Het
Zswim1 T C 2: 164,825,785 V319A probably benign Het
Other mutations in Olfr1155
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02507:Olfr1155 APN 2 87942918 nonsense probably null
IGL03245:Olfr1155 APN 2 87942742 missense possibly damaging 0.75
B5639:Olfr1155 UTSW 2 87943598 missense probably benign 0.03
PIT4531001:Olfr1155 UTSW 2 87943227 missense probably damaging 1.00
R0212:Olfr1155 UTSW 2 87943091 missense probably damaging 1.00
R0393:Olfr1155 UTSW 2 87943565 missense possibly damaging 0.62
R1178:Olfr1155 UTSW 2 87943146 missense probably benign 0.02
R1180:Olfr1155 UTSW 2 87943146 missense probably benign 0.02
R1181:Olfr1155 UTSW 2 87943146 missense probably benign 0.02
R1266:Olfr1155 UTSW 2 87943533 missense probably benign 0.01
R1847:Olfr1155 UTSW 2 87942721 splice site probably null
R1998:Olfr1155 UTSW 2 87943146 missense probably benign 0.02
R2000:Olfr1155 UTSW 2 87943146 missense probably benign 0.02
R4119:Olfr1155 UTSW 2 87943443 missense probably damaging 1.00
R5157:Olfr1155 UTSW 2 87942888 missense probably benign
R5688:Olfr1155 UTSW 2 87943208 missense probably benign 0.02
R5731:Olfr1155 UTSW 2 87943427 missense possibly damaging 0.89
R6064:Olfr1155 UTSW 2 87943484 missense probably benign 0.00
R6372:Olfr1155 UTSW 2 87942975 missense probably benign 0.00
R6505:Olfr1155 UTSW 2 87943174 nonsense probably null
R6555:Olfr1155 UTSW 2 87943288 missense probably damaging 1.00
R6909:Olfr1155 UTSW 2 87942690 missense probably benign 0.27
R7257:Olfr1155 UTSW 2 87943571 missense probably damaging 1.00
R8037:Olfr1155 UTSW 2 87942975 missense probably benign 0.00
R8367:Olfr1155 UTSW 2 87943097 missense possibly damaging 0.75
R9301:Olfr1155 UTSW 2 87942953 missense probably benign 0.00
Z1088:Olfr1155 UTSW 2 87943448 missense probably damaging 1.00
Z1176:Olfr1155 UTSW 2 87943209 missense possibly damaging 0.57
Z1176:Olfr1155 UTSW 2 87943467 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGGGCAGTGACAACAATG -3'
(R):5'- TCCCAAGATGCTGGTGAACC -3'

Sequencing Primer
(F):5'- GCAGTGACAACAATGAACAAATACG -3'
(R):5'- ACCTTGTTGTAGAAGATAGGACC -3'
Posted On 2015-06-10