Mutagenetix > Incidental Mutations

Incidental Mutation 'R4213:Olfr1155'

319288

Institutional Source

Beutler Lab

Gene Symbol

Olfr1155

Ensembl Gene

ENSMUSG00000075145

Gene Name

olfactory receptor 1155

Synonyms

GA_x6K02T2Q125-49426894-49425950, MOR174-10

MMRRC Submission

041040-MU

Accession Numbers

Genbank: NM_146643; MGI: 3030989

Is this an essential gene?

Probably non essential (E-score: 0.079) question?

Stock #

R4213 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

87941645-87945137 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 87943121 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 169 (Y169C)

Ref Sequence

ENSEMBL: ENSMUSP00000149428 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099843] [ENSMUST00000214641] [ENSMUST00000215903] [ENSMUST00000216191] [ENSMUST00000216726]

Predicted Effect

probably benign
Transcript: ENSMUST00000099843
AA Change: Y169C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000097431
Gene: ENSMUSG00000075145
AA Change: Y169C

Domain	Start	End	E-Value	Type
Pfam:7tm_4	33	310	2.7e-44	PFAM
Pfam:7tm_1	43	292	5.3e-16	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000214641
AA Change: Y169C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

probably benign
Transcript: ENSMUST00000215903
AA Change: Y169C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

probably benign
Transcript: ENSMUST00000216191

Predicted Effect

probably benign
Transcript: ENSMUST00000216726

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.6%

Validation Efficiency

97% (38/39)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310050C09Rik	G	A	3: 92,869,127	P83L	probably benign	Het
Ankrd11	A	C	8: 122,891,026	V2029G	probably benign	Het
Arhgap28	A	T	17: 67,871,993	V291E	probably benign	Het
Cad	G	A	5: 31,072,344	V1390I	probably benign	Het
Cadps2	A	T	6: 23,599,463	D281E	probably damaging	Het
Celsr1	G	A	15: 86,031,807	T655I	probably damaging	Het
Cep350	C	G	1: 155,935,961	G411A	probably damaging	Het
Chml	A	T	1: 175,686,695	F210L	probably damaging	Het
Col4a4	A	T	1: 82,453,144	M1679K	unknown	Het
Depdc1b	T	G	13: 108,388,691	F527V	probably damaging	Het
Dsg2	T	C	18: 20,598,514	L731P	probably benign	Het
Fam69b	C	T	2: 26,635,948	T298I	probably benign	Het
Fbxo25	A	G	8: 13,939,581	T343A	probably damaging	Het
Gk5	T	C	9: 96,129,053	L72P	probably damaging	Het
Gm15448	C	A	7: 3,821,554	A510S	probably damaging	Het
Gm648	C	T	X: 56,545,208	V78I	probably benign	Het
Gpr137c	G	A	14: 45,246,508	E231K	probably damaging	Het
Hdc	C	T	2: 126,597,866		probably null	Het
Hydin	A	G	8: 110,456,507	N1112S	possibly damaging	Het
Itgae	A	G	11: 73,119,352	H556R	probably benign	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 52,725,906		probably benign	Het
Krtap17-1	A	G	11: 99,993,914	L9P	unknown	Het
Nmur1	T	G	1: 86,387,784	T87P	probably damaging	Het
Ppp2r5e	A	G	12: 75,469,551	I244T	probably damaging	Het
Robo3	C	T	9: 37,421,898	G781D	probably damaging	Het
Siglec1	C	T	2: 131,074,118	E1275K	probably damaging	Het
Slc2a12	A	T	10: 22,702,094	K596N	probably benign	Het
Sorcs1	G	A	19: 50,225,175	R705C	probably damaging	Het
Sqor	G	T	2: 122,787,498	G92V	probably damaging	Het
Tlr4	T	A	4: 66,840,326	I452N	probably damaging	Het
Tob1	A	G	11: 94,214,192	T185A	probably damaging	Het
Yjefn3	G	T	8: 69,890,890	H50Q	probably benign	Het
Zswim1	T	C	2: 164,825,785	V319A	probably benign	Het

Other mutations in Olfr1155

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02507:Olfr1155	APN	2	87942918	nonsense	probably null
IGL03245:Olfr1155	APN	2	87942742	missense	possibly damaging	0.75
B5639:Olfr1155	UTSW	2	87943598	missense	probably benign	0.03
PIT4531001:Olfr1155	UTSW	2	87943227	missense	probably damaging	1.00
R0212:Olfr1155	UTSW	2	87943091	missense	probably damaging	1.00
R0393:Olfr1155	UTSW	2	87943565	missense	possibly damaging	0.62
R1178:Olfr1155	UTSW	2	87943146	missense	probably benign	0.02
R1180:Olfr1155	UTSW	2	87943146	missense	probably benign	0.02
R1181:Olfr1155	UTSW	2	87943146	missense	probably benign	0.02
R1266:Olfr1155	UTSW	2	87943533	missense	probably benign	0.01
R1847:Olfr1155	UTSW	2	87942721	splice site	probably null
R1998:Olfr1155	UTSW	2	87943146	missense	probably benign	0.02
R2000:Olfr1155	UTSW	2	87943146	missense	probably benign	0.02
R4119:Olfr1155	UTSW	2	87943443	missense	probably damaging	1.00
R5157:Olfr1155	UTSW	2	87942888	missense	probably benign
R5688:Olfr1155	UTSW	2	87943208	missense	probably benign	0.02
R5731:Olfr1155	UTSW	2	87943427	missense	possibly damaging	0.89
R6064:Olfr1155	UTSW	2	87943484	missense	probably benign	0.00
R6372:Olfr1155	UTSW	2	87942975	missense	probably benign	0.00
R6505:Olfr1155	UTSW	2	87943174	nonsense	probably null
R6555:Olfr1155	UTSW	2	87943288	missense	probably damaging	1.00
R6909:Olfr1155	UTSW	2	87942690	missense	probably benign	0.27
R7257:Olfr1155	UTSW	2	87943571	missense	probably damaging	1.00
R8037:Olfr1155	UTSW	2	87942975	missense	probably benign	0.00
R8367:Olfr1155	UTSW	2	87943097	missense	possibly damaging	0.75
Z1088:Olfr1155	UTSW	2	87943448	missense	probably damaging	1.00
Z1176:Olfr1155	UTSW	2	87943209	missense	possibly damaging	0.57
Z1176:Olfr1155	UTSW	2	87943467	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAGGGCAGTGACAACAATG -3'
(R):5'- TCCCAAGATGCTGGTGAACC -3'

Sequencing Primer
(F):5'- GCAGTGACAACAATGAACAAATACG -3'
(R):5'- ACCTTGTTGTAGAAGATAGGACC -3'

Posted On

2015-06-10