Mutagenetix > Incidental Mutation

Incidental Mutation 'R0395:Shroom3'

31929

Institutional Source

Beutler Lab

Gene Symbol

Shroom3

Ensembl Gene

ENSMUSG00000029381

Gene Name

shroom family member 3

Synonyms

D5Ertd287e, Shrm3, Shrm

MMRRC Submission

038601-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0395 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

92683435-92965318 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 92780903 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 106 (R106C)

Ref Sequence

ENSEMBL: ENSMUSP00000108678 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113055] [ENSMUST00000168878]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000113055
AA Change: R106C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108678
Gene: ENSMUSG00000029381
AA Change: R106C

Domain	Start	End	E-Value	Type
PDZ	35	109	5.81e-11	SMART
low complexity region	191	202	N/A	INTRINSIC
low complexity region	258	268	N/A	INTRINSIC
low complexity region	747	761	N/A	INTRINSIC
low complexity region	796	814	N/A	INTRINSIC
low complexity region	860	879	N/A	INTRINSIC
Pfam:ASD1	882	1060	1e-57	PFAM
low complexity region	1114	1127	N/A	INTRINSIC
low complexity region	1307	1318	N/A	INTRINSIC
low complexity region	1347	1359	N/A	INTRINSIC
low complexity region	1449	1463	N/A	INTRINSIC
low complexity region	1508	1520	N/A	INTRINSIC
Pfam:ASD2	1654	1940	9.9e-112	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000168878
AA Change: R106C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000130419
Gene: ENSMUSG00000029381
AA Change: R106C

Domain	Start	End	E-Value	Type
PDZ	35	109	5.81e-11	SMART
low complexity region	191	202	N/A	INTRINSIC
low complexity region	258	268	N/A	INTRINSIC
low complexity region	747	761	N/A	INTRINSIC
low complexity region	796	814	N/A	INTRINSIC
low complexity region	860	879	N/A	INTRINSIC
low complexity region	983	996	N/A	INTRINSIC
low complexity region	1176	1187	N/A	INTRINSIC
low complexity region	1216	1228	N/A	INTRINSIC
low complexity region	1318	1332	N/A	INTRINSIC
low complexity region	1377	1389	N/A	INTRINSIC
Pfam:ASD2	1522	1809	8.9e-108	PFAM

Meta Mutation Damage Score

0.4027

Coding Region Coverage

1x: 99.1%
3x: 98.1%
10x: 95.9%
20x: 91.4%

Validation Efficiency

98% (103/105)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a PDZ-domain-containing protein that belongs to a family of Shroom-related proteins. This protein may be involved in regulating cell shape in certain tissues. A similar protein in mice is required for proper neurulation. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous mutation of this locus results in failed neural tube closure leading to exencephaly, acrania, facial clefting, and spina bifida. Homozygotes develop to term but die either at birth or shortly thereafter. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 103 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921517D22Rik	T	C	13: 59,689,656	K205R	possibly damaging	Het
9630041A04Rik	A	T	9: 101,942,735	N118I	probably damaging	Het
Acsm2	G	A	7: 119,575,746	D245N	probably damaging	Het
Adgrv1	A	T	13: 81,385,953	H5836Q	probably benign	Het
Ahcyl2	T	C	6: 29,886,168	V391A	probably damaging	Het
Alcam	A	T	16: 52,309,864	M41K	probably benign	Het
Aldh3b3	A	C	19: 3,966,472	E363D	probably benign	Het
Alk	A	G	17: 72,603,531	V60A	probably damaging	Het
Als2cl	G	A	9: 110,898,084	R906H	probably damaging	Het
Ap5z1	T	C	5: 142,470,562		probably benign	Het
Apba2	T	A	7: 64,743,408	I547N	probably benign	Het
Apol10b	A	T	15: 77,585,640	D112E	probably damaging	Het
Ash1l	C	A	3: 89,058,589	R2433S	probably damaging	Het
Cachd1	T	C	4: 100,953,205	F335L	probably damaging	Het
Cbfa2t3	G	T	8: 122,638,951	Q181K	probably benign	Het
Cct6b	A	G	11: 82,739,680	M265T	probably benign	Het
Cd151	G	A	7: 141,470,391	V180I	probably damaging	Het
Ces1h	T	A	8: 93,357,078	N412I	unknown	Het
Chmp7	T	C	14: 69,732,456	T12A	probably benign	Het
Clasp1	A	G	1: 118,539,331	T534A	possibly damaging	Het
Cldn15	T	A	5: 136,968,198	V31E	possibly damaging	Het
Col16a1	G	A	4: 130,073,109	G583D	probably damaging	Het
Csmd1	T	C	8: 16,346,638	N426S	probably damaging	Het
Dapp1	C	T	3: 137,935,637	C199Y	possibly damaging	Het
Dchs1	A	G	7: 105,758,538	L2029P	probably damaging	Het
Diexf	T	C	1: 193,123,676	E187G	possibly damaging	Het
Dmc1	A	G	15: 79,588,772	F158S	probably damaging	Het
Dst	C	T	1: 34,189,119	P1606L	probably damaging	Het
Dthd1	T	A	5: 62,814,333	N166K	possibly damaging	Het
Enam	A	T	5: 88,501,508	Y292F	probably damaging	Het
Esrrg	A	T	1: 188,198,635	I285F	probably damaging	Het
Fam19a2	A	T	10: 123,593,592	H37L	probably benign	Het
Fam50b	A	G	13: 34,747,237	D232G	probably damaging	Het
Fam91a1	T	A	15: 58,454,792	S792T	probably benign	Het
Fbxw22	A	C	9: 109,381,685	C419W	probably damaging	Het
Flt4	G	A	11: 49,630,343	S393N	probably benign	Het
Fras1	A	T	5: 96,769,653	T3511S	possibly damaging	Het
Frat2	A	C	19: 41,847,824	S30A	probably damaging	Het
Glp1r	T	A	17: 30,936,338	M433K	probably benign	Het
Gm10300	G	A	4: 132,074,988		probably benign	Het
Gm13178	A	G	4: 144,703,195	V408A	probably benign	Het
Gm684	C	T	9: 51,280,534		probably benign	Het
Gpatch4	A	G	3: 88,054,354		probably benign	Het
Gpr22	A	T	12: 31,709,462	S220R	possibly damaging	Het
Grn	T	C	11: 102,436,223	V549A	probably benign	Het
Gtf3c5	T	C	2: 28,577,918	D177G	probably damaging	Het
Htr1b	A	T	9: 81,631,651	M301K	probably benign	Het
Ifi207	A	T	1: 173,729,865	S436T	possibly damaging	Het
Ifnb1	A	T	4: 88,522,529	N82K	possibly damaging	Het
Ina	T	G	19: 47,021,919	N384K	probably damaging	Het
Kirrel2	T	C	7: 30,450,458	N541D	possibly damaging	Het
Lrp2	A	T	2: 69,433,077	I4377N	possibly damaging	Het
Lrrc37a	A	G	11: 103,464,395	V2532A	unknown	Het
Mast4	T	C	13: 102,735,273	E2529G	probably damaging	Het
Myh6	T	C	14: 54,946,320	H1719R	possibly damaging	Het
Myo5a	A	T	9: 75,193,977	H150L	probably benign	Het
Naglu	C	T	11: 101,074,107		probably benign	Het
Nags	G	A	11: 102,145,704	A40T	unknown	Het
Nav1	G	T	1: 135,532,621	Y321*	probably null	Het
Nav1	A	T	1: 135,532,623	Y321N	probably damaging	Het
Neu3	C	T	7: 99,813,778	S246N	probably benign	Het
Npy5r	C	T	8: 66,681,973	G56D	probably benign	Het
Nrxn1	A	G	17: 91,088,314	V138A	possibly damaging	Het
Nuggc	C	T	14: 65,613,472	Q264*	probably null	Het
Ogfod1	G	A	8: 94,063,528		probably null	Het
Olfr108	T	A	17: 37,445,866	F115Y	probably damaging	Het
Olfr1453	A	G	19: 13,028,299	F10S	probably damaging	Het
Olfr315	A	T	11: 58,778,369	M81L	probably benign	Het
Olfr490	A	G	7: 108,286,271	V285A	probably benign	Het
Per1	T	A	11: 69,102,277	I340N	probably damaging	Het
Pkhd1	C	T	1: 20,381,547	A2175T	probably benign	Het
Pogk	A	G	1: 166,403,602	V52A	probably damaging	Het
Ppib	A	T	9: 66,066,319	T185S	possibly damaging	Het
Ptar1	G	T	19: 23,720,199	M358I	probably damaging	Het
Qser1	A	C	2: 104,762,881	I1597S	probably damaging	Het
Ranbp17	T	C	11: 33,474,896	I487V	probably benign	Het
Repin1	C	A	6: 48,597,525	R460S	probably damaging	Het
Sfmbt1	T	C	14: 30,787,617		probably benign	Het
Sh3rf1	C	T	8: 61,393,662		probably benign	Het
Siglecf	T	A	7: 43,355,975	V453D	probably damaging	Het
Slc2a9	A	G	5: 38,453,169	S96P	probably damaging	Het
Slc5a2	A	G	7: 128,267,482	Y124C	probably damaging	Het
Slf1	A	G	13: 77,105,969		probably benign	Het
Smad1	T	G	8: 79,349,782	K269T	probably benign	Het
Srp54b	G	A	12: 55,250,099	R194H	probably damaging	Het
St8sia6	T	A	2: 13,665,436	S238C	probably damaging	Het
Stat3	A	T	11: 100,889,937		probably benign	Het
Tas1r2	T	A	4: 139,655,354	M101K	possibly damaging	Het
Tesc	A	G	5: 118,053,582		probably null	Het
Tle3	T	A	9: 61,410,071	M334K	probably damaging	Het
Tmem151a	A	T	19: 5,082,233	V315E	probably damaging	Het
Tmprss2	T	C	16: 97,567,045	D480G	probably damaging	Het
Trmt1	C	A	8: 84,697,112		probably null	Het
Tsr3	T	C	17: 25,242,224		probably null	Het
Ube2u	A	G	4: 100,481,648	K37E	probably benign	Het
Usp16	T	A	16: 87,475,446	D382E	probably damaging	Het
Usp9y	A	T	Y: 1,340,053	F1442Y	probably damaging	Het
Utp20	A	T	10: 88,818,595	M210K	probably damaging	Het
V1ra8	C	T	6: 90,203,009	L65F	possibly damaging	Het
Vmn2r10	T	C	5: 109,001,993	N395S	probably damaging	Het
Vmn2r100	C	A	17: 19,522,120	P252Q	possibly damaging	Het
Zfp217	C	T	2: 170,115,462	A539T	probably benign	Het
Zfp330	G	A	8: 82,764,882	Q221*	probably null	Het

Other mutations in Shroom3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00850:Shroom3	APN	5	92951065	missense	probably damaging	1.00
IGL01086:Shroom3	APN	5	92948452	missense	probably benign	0.01
IGL01363:Shroom3	APN	5	92940993	missense	probably benign	0.01
IGL01468:Shroom3	APN	5	92940342	missense	probably damaging	1.00
IGL01675:Shroom3	APN	5	92941680	missense	probably damaging	0.99
IGL01862:Shroom3	APN	5	92962289	missense	probably damaging	1.00
IGL01987:Shroom3	APN	5	92942189	missense	probably damaging	0.99
IGL02104:Shroom3	APN	5	92940389	missense	probably benign	0.32
IGL03248:Shroom3	APN	5	92952540	missense	probably benign	0.00
IGL03386:Shroom3	APN	5	92948483	splice site	probably benign
R0167:Shroom3	UTSW	5	92948395	splice site	probably benign
R0388:Shroom3	UTSW	5	92951293	missense	probably benign	0.39
R0567:Shroom3	UTSW	5	92964453	missense	possibly damaging	0.53
R1496:Shroom3	UTSW	5	92942834	missense	possibly damaging	0.69
R1772:Shroom3	UTSW	5	92940656	missense	probably damaging	0.97
R1845:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R1921:Shroom3	UTSW	5	92962365	critical splice donor site	probably null
R2059:Shroom3	UTSW	5	92683784	missense	probably damaging	1.00
R2203:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2204:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2205:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2301:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2344:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2345:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2346:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2348:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2371:Shroom3	UTSW	5	92780870	missense	probably damaging	1.00
R2435:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2829:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2830:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2831:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2897:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2898:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3079:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3080:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3433:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3729:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3730:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3735:Shroom3	UTSW	5	92964444	missense	possibly damaging	0.84
R3736:Shroom3	UTSW	5	92964444	missense	possibly damaging	0.84
R3851:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3852:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3943:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3969:Shroom3	UTSW	5	92940879	missense	probably benign	0.05
R4008:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4009:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4012:Shroom3	UTSW	5	92948483	splice site	probably benign
R4154:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4157:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4172:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4173:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4201:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4202:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4204:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4205:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4206:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4284:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4285:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4364:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4384:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4456:Shroom3	UTSW	5	92940999	missense	probably benign	0.14
R4707:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4712:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4751:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4755:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4760:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4773:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4774:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4776:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4801:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4802:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4856:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4857:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4860:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4860:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4882:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4883:Shroom3	UTSW	5	92951134	missense	probably benign	0.14
R4886:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R5262:Shroom3	UTSW	5	92964573	missense	probably damaging	1.00
R5271:Shroom3	UTSW	5	92962248	missense	probably damaging	1.00
R5719:Shroom3	UTSW	5	92943018	missense	probably benign	0.04
R5726:Shroom3	UTSW	5	92943005	missense	probably benign	0.00
R5993:Shroom3	UTSW	5	92940188	missense	probably damaging	1.00
R6078:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R6079:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R6138:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R6153:Shroom3	UTSW	5	92964408	missense	probably damaging	0.99
R6493:Shroom3	UTSW	5	92941561	missense	probably benign	0.03
R6495:Shroom3	UTSW	5	92942069	missense	possibly damaging	0.66
R6693:Shroom3	UTSW	5	92940758	missense	possibly damaging	0.61
R6801:Shroom3	UTSW	5	92940936	missense	probably damaging	1.00
R6893:Shroom3	UTSW	5	92942204	missense	probably damaging	0.97
R6912:Shroom3	UTSW	5	92943017	missense	probably benign	0.02
R6924:Shroom3	UTSW	5	92964403	missense	probably damaging	1.00
R7083:Shroom3	UTSW	5	92964525	missense	probably damaging	1.00
R7197:Shroom3	UTSW	5	92942604	missense	probably damaging	1.00
R7366:Shroom3	UTSW	5	92964606	nonsense	probably null
R7712:Shroom3	UTSW	5	92950947	missense	probably benign	0.01
R7725:Shroom3	UTSW	5	92941653	missense	probably benign	0.19
R7728:Shroom3	UTSW	5	92683707	missense	possibly damaging	0.73
R7774:Shroom3	UTSW	5	92950489	missense	probably damaging	0.98
R7795:Shroom3	UTSW	5	92919649	missense	probably damaging	0.99
R7821:Shroom3	UTSW	5	92940846	missense	probably damaging	0.98
R7971:Shroom3	UTSW	5	92951074	missense	probably damaging	1.00
R8276:Shroom3	UTSW	5	92940480	missense	probably damaging	0.99
R8934:Shroom3	UTSW	5	92941725	missense	probably damaging	1.00
R8938:Shroom3	UTSW	5	92943071	missense	probably damaging	1.00
R9083:Shroom3	UTSW	5	92950674	missense	probably damaging	0.97
R9108:Shroom3	UTSW	5	92940116	missense	probably damaging	1.00
R9124:Shroom3	UTSW	5	92964542	missense	probably benign	0.19
R9295:Shroom3	UTSW	5	92950619	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGATTACACTTTGGCCCGGTGC -3'
(R):5'- CCACCAGTCTTTTAGCCCTGAGTTG -3'

Sequencing Primer
(F):5'- GCTGGACACAGAGTCACTG -3'
(R):5'- CTGAGTTGTAGGCACAGCTAAC -3'

Posted On

2013-04-24