Incidental Mutation 'R4213:Fbxo25'
Institutional Source Beutler Lab
Gene Symbol Fbxo25
Ensembl Gene ENSMUSG00000038365
Gene NameF-box protein 25
Synonyms9130015I06Rik, Fbx25
MMRRC Submission 041040-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.238) question?
Stock #R4213 (G1)
Quality Score225
Status Validated
Chromosomal Location13907803-13940522 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13939581 bp
Amino Acid Change Threonine to Alanine at position 343 (T343A)
Ref Sequence ENSEMBL: ENSMUSP00000147467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043520] [ENSMUST00000209913]
Predicted Effect probably damaging
Transcript: ENSMUST00000043520
AA Change: T335A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039544
Gene: ENSMUSG00000038365
AA Change: T335A

low complexity region 209 222 N/A INTRINSIC
Blast:FBOX 230 271 1e-19 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209310
Predicted Effect probably damaging
Transcript: ENSMUST00000209913
AA Change: T343A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000210280
Meta Mutation Damage Score 0.3260 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. Three alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik G A 3: 92,869,127 P83L probably benign Het
Ankrd11 A C 8: 122,891,026 V2029G probably benign Het
Arhgap28 A T 17: 67,871,993 V291E probably benign Het
Cad G A 5: 31,072,344 V1390I probably benign Het
Cadps2 A T 6: 23,599,463 D281E probably damaging Het
Celsr1 G A 15: 86,031,807 T655I probably damaging Het
Cep350 C G 1: 155,935,961 G411A probably damaging Het
Chml A T 1: 175,686,695 F210L probably damaging Het
Col4a4 A T 1: 82,453,144 M1679K unknown Het
Depdc1b T G 13: 108,388,691 F527V probably damaging Het
Dsg2 T C 18: 20,598,514 L731P probably benign Het
Fam69b C T 2: 26,635,948 T298I probably benign Het
Gk5 T C 9: 96,129,053 L72P probably damaging Het
Gm15448 C A 7: 3,821,554 A510S probably damaging Het
Gm648 C T X: 56,545,208 V78I probably benign Het
Gpr137c G A 14: 45,246,508 E231K probably damaging Het
Hdc C T 2: 126,597,866 probably null Het
Hydin A G 8: 110,456,507 N1112S possibly damaging Het
Itgae A G 11: 73,119,352 H556R probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Krtap17-1 A G 11: 99,993,914 L9P unknown Het
Nmur1 T G 1: 86,387,784 T87P probably damaging Het
Olfr1155 T C 2: 87,943,121 Y169C probably benign Het
Ppp2r5e A G 12: 75,469,551 I244T probably damaging Het
Robo3 C T 9: 37,421,898 G781D probably damaging Het
Siglec1 C T 2: 131,074,118 E1275K probably damaging Het
Slc2a12 A T 10: 22,702,094 K596N probably benign Het
Sorcs1 G A 19: 50,225,175 R705C probably damaging Het
Sqor G T 2: 122,787,498 G92V probably damaging Het
Tlr4 T A 4: 66,840,326 I452N probably damaging Het
Tob1 A G 11: 94,214,192 T185A probably damaging Het
Yjefn3 G T 8: 69,890,890 H50Q probably benign Het
Zswim1 T C 2: 164,825,785 V319A probably benign Het
Other mutations in Fbxo25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02226:Fbxo25 APN 8 13923922 unclassified probably benign
IGL03087:Fbxo25 APN 8 13924019 critical splice donor site probably null
IGL03112:Fbxo25 APN 8 13921034 missense probably benign 0.18
IGL03403:Fbxo25 APN 8 13929423 missense probably benign 0.00
R0720:Fbxo25 UTSW 8 13935222 missense probably damaging 1.00
R0755:Fbxo25 UTSW 8 13935219 missense probably benign 0.00
R1865:Fbxo25 UTSW 8 13935248 missense probably damaging 1.00
R2043:Fbxo25 UTSW 8 13921905 missense probably damaging 0.99
R4248:Fbxo25 UTSW 8 13939617 missense probably damaging 1.00
R5380:Fbxo25 UTSW 8 13921886 missense probably benign 0.10
R7450:Fbxo25 UTSW 8 13931235 missense probably benign 0.09
R8264:Fbxo25 UTSW 8 13929393 missense possibly damaging 0.89
R8409:Fbxo25 UTSW 8 13914999 nonsense probably null
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-06-10