Incidental Mutation 'R4213:Depdc1b'
ID319312
Institutional Source Beutler Lab
Gene Symbol Depdc1b
Ensembl Gene ENSMUSG00000021697
Gene NameDEP domain containing 1B
SynonymsXTP1
MMRRC Submission 041040-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R4213 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location108316332-108407782 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 108388691 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 527 (F527V)
Ref Sequence ENSEMBL: ENSMUSP00000131707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051594] [ENSMUST00000163307] [ENSMUST00000171178]
Predicted Effect probably damaging
Transcript: ENSMUST00000051594
AA Change: F527V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059291
Gene: ENSMUSG00000021697
AA Change: F527V

DomainStartEndE-ValueType
DEP 24 108 4.36e-20 SMART
Pfam:RhoGAP 267 347 8.3e-10 PFAM
low complexity region 464 480 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163307
AA Change: F527V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131707
Gene: ENSMUSG00000021697
AA Change: F527V

DomainStartEndE-ValueType
DEP 24 108 4.36e-20 SMART
Pfam:RhoGAP 264 347 7.9e-10 PFAM
low complexity region 464 480 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171178
AA Change: F465V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132972
Gene: ENSMUSG00000021697
AA Change: F465V

DomainStartEndE-ValueType
DEP 24 108 4.36e-20 SMART
Pfam:RhoGAP 264 347 9.1e-10 PFAM
Meta Mutation Damage Score 0.1443 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 97% (38/39)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik G A 3: 92,869,127 P83L probably benign Het
Ankrd11 A C 8: 122,891,026 V2029G probably benign Het
Arhgap28 A T 17: 67,871,993 V291E probably benign Het
Cad G A 5: 31,072,344 V1390I probably benign Het
Cadps2 A T 6: 23,599,463 D281E probably damaging Het
Celsr1 G A 15: 86,031,807 T655I probably damaging Het
Cep350 C G 1: 155,935,961 G411A probably damaging Het
Chml A T 1: 175,686,695 F210L probably damaging Het
Col4a4 A T 1: 82,453,144 M1679K unknown Het
Dsg2 T C 18: 20,598,514 L731P probably benign Het
Fam69b C T 2: 26,635,948 T298I probably benign Het
Fbxo25 A G 8: 13,939,581 T343A probably damaging Het
Gk5 T C 9: 96,129,053 L72P probably damaging Het
Gm15448 C A 7: 3,821,554 A510S probably damaging Het
Gm648 C T X: 56,545,208 V78I probably benign Het
Gpr137c G A 14: 45,246,508 E231K probably damaging Het
Hdc C T 2: 126,597,866 probably null Het
Hydin A G 8: 110,456,507 N1112S possibly damaging Het
Itgae A G 11: 73,119,352 H556R probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Krtap17-1 A G 11: 99,993,914 L9P unknown Het
Nmur1 T G 1: 86,387,784 T87P probably damaging Het
Olfr1155 T C 2: 87,943,121 Y169C probably benign Het
Ppp2r5e A G 12: 75,469,551 I244T probably damaging Het
Robo3 C T 9: 37,421,898 G781D probably damaging Het
Siglec1 C T 2: 131,074,118 E1275K probably damaging Het
Slc2a12 A T 10: 22,702,094 K596N probably benign Het
Sorcs1 G A 19: 50,225,175 R705C probably damaging Het
Sqor G T 2: 122,787,498 G92V probably damaging Het
Tlr4 T A 4: 66,840,326 I452N probably damaging Het
Tob1 A G 11: 94,214,192 T185A probably damaging Het
Yjefn3 G T 8: 69,890,890 H50Q probably benign Het
Zswim1 T C 2: 164,825,785 V319A probably benign Het
Other mutations in Depdc1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Depdc1b APN 13 108357440 missense probably benign
IGL01071:Depdc1b APN 13 108357441 missense probably benign
IGL01778:Depdc1b APN 13 108362327 missense probably benign 0.02
IGL02368:Depdc1b APN 13 108363579 missense probably benign
R0310:Depdc1b UTSW 13 108373841 missense possibly damaging 0.88
R0483:Depdc1b UTSW 13 108373848 missense probably benign 0.03
R0650:Depdc1b UTSW 13 108323909 missense probably damaging 1.00
R0900:Depdc1b UTSW 13 108362260 missense possibly damaging 0.68
R0932:Depdc1b UTSW 13 108386835 missense probably benign 0.23
R1757:Depdc1b UTSW 13 108323948 missense probably damaging 1.00
R2174:Depdc1b UTSW 13 108362253 nonsense probably null
R2308:Depdc1b UTSW 13 108373841 missense possibly damaging 0.88
R3941:Depdc1b UTSW 13 108368836 missense probably damaging 1.00
R4613:Depdc1b UTSW 13 108363643 missense probably damaging 1.00
R4771:Depdc1b UTSW 13 108382900 missense probably benign 0.14
R5224:Depdc1b UTSW 13 108384820 missense probably damaging 1.00
R5292:Depdc1b UTSW 13 108373842 missense probably damaging 0.99
R6241:Depdc1b UTSW 13 108324119 missense possibly damaging 0.78
R6399:Depdc1b UTSW 13 108324046 missense probably damaging 1.00
R6418:Depdc1b UTSW 13 108357422 missense probably damaging 0.97
R7078:Depdc1b UTSW 13 108386971 missense possibly damaging 0.93
R7120:Depdc1b UTSW 13 108362247 missense probably benign 0.01
R7127:Depdc1b UTSW 13 108323928 missense probably damaging 1.00
R7209:Depdc1b UTSW 13 108382855 missense possibly damaging 0.55
R7385:Depdc1b UTSW 13 108363632 missense probably damaging 1.00
R8098:Depdc1b UTSW 13 108324059 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTCTTTGGACTCATAGTGGACTC -3'
(R):5'- GTAACCTACCCAAGCCTGTTC -3'

Sequencing Primer
(F):5'- GGACTCATAGTGGACTCATATTCAG -3'
(R):5'- TTTACATCTCTACAAACAGCATCGAG -3'
Posted On2015-06-10