Incidental Mutation 'R4213:Dsg2'
ID 319317
Institutional Source Beutler Lab
Gene Symbol Dsg2
Ensembl Gene ENSMUSG00000044393
Gene Name desmoglein 2
Synonyms D18Ertd293e
MMRRC Submission 041040-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.202) question?
Stock # R4213 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 20691131-20737578 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 20731571 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 731 (L731P)
Ref Sequence ENSEMBL: ENSMUSP00000057096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059787]
AlphaFold O55111
Predicted Effect probably benign
Transcript: ENSMUST00000059787
AA Change: L731P

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000057096
Gene: ENSMUSG00000044393
AA Change: L731P

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 75 162 2.39e-8 SMART
CA 186 275 5.17e-27 SMART
CA 298 392 1.94e-8 SMART
CA 418 502 2.34e-16 SMART
transmembrane domain 618 640 N/A INTRINSIC
low complexity region 822 838 N/A INTRINSIC
low complexity region 914 928 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130296
Meta Mutation Damage Score 0.1318 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Mice lacking the encoded protein die in utero. Mutant mice lacking a part of the extracellular adhesive domain of the encoded protein develop cardiac fibrosis and dilation. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality before somite formation, impaired cell proliferation, and increased apoptosis. Heterozygous mutation of this gene also results in embryonic lethality before somite formation with partial penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd11 A C 8: 123,617,765 (GRCm39) V2029G probably benign Het
Arhgap28 A T 17: 68,178,988 (GRCm39) V291E probably benign Het
Cad G A 5: 31,229,688 (GRCm39) V1390I probably benign Het
Cadps2 A T 6: 23,599,462 (GRCm39) D281E probably damaging Het
Celsr1 G A 15: 85,916,008 (GRCm39) T655I probably damaging Het
Cep350 C G 1: 155,811,707 (GRCm39) G411A probably damaging Het
Chml A T 1: 175,514,261 (GRCm39) F210L probably damaging Het
Col4a4 A T 1: 82,430,865 (GRCm39) M1679K unknown Het
Ct45a C T X: 55,590,568 (GRCm39) V78I probably benign Het
Depdc1b T G 13: 108,525,225 (GRCm39) F527V probably damaging Het
Dipk1b C T 2: 26,525,960 (GRCm39) T298I probably benign Het
Fbxo25 A G 8: 13,989,581 (GRCm39) T343A probably damaging Het
Gk5 T C 9: 96,011,106 (GRCm39) L72P probably damaging Het
Gpr137c G A 14: 45,483,965 (GRCm39) E231K probably damaging Het
Hdc C T 2: 126,439,786 (GRCm39) probably null Het
Hydin A G 8: 111,183,139 (GRCm39) N1112S possibly damaging Het
Itgae A G 11: 73,010,178 (GRCm39) H556R probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 53,032,934 (GRCm39) 74 probably benign Het
Kplce G A 3: 92,776,434 (GRCm39) P83L probably benign Het
Krtap17-1 A G 11: 99,884,740 (GRCm39) L9P unknown Het
Nmur1 T G 1: 86,315,506 (GRCm39) T87P probably damaging Het
Or5d16 T C 2: 87,773,465 (GRCm39) Y169C probably benign Het
Pira13 C A 7: 3,824,553 (GRCm39) A510S probably damaging Het
Ppp2r5e A G 12: 75,516,325 (GRCm39) I244T probably damaging Het
Robo3 C T 9: 37,333,194 (GRCm39) G781D probably damaging Het
Siglec1 C T 2: 130,916,038 (GRCm39) E1275K probably damaging Het
Slc2a12 A T 10: 22,577,993 (GRCm39) K596N probably benign Het
Sorcs1 G A 19: 50,213,613 (GRCm39) R705C probably damaging Het
Sqor G T 2: 122,629,418 (GRCm39) G92V probably damaging Het
Tlr4 T A 4: 66,758,563 (GRCm39) I452N probably damaging Het
Tob1 A G 11: 94,105,018 (GRCm39) T185A probably damaging Het
Yjefn3 G T 8: 70,343,540 (GRCm39) H50Q probably benign Het
Zswim1 T C 2: 164,667,705 (GRCm39) V319A probably benign Het
Other mutations in Dsg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Dsg2 APN 18 20,734,826 (GRCm39) missense probably benign 0.10
IGL00979:Dsg2 APN 18 20,715,824 (GRCm39) missense probably damaging 0.99
IGL01081:Dsg2 APN 18 20,722,999 (GRCm39) unclassified probably benign
IGL01358:Dsg2 APN 18 20,734,850 (GRCm39) missense probably damaging 0.98
IGL02002:Dsg2 APN 18 20,712,233 (GRCm39) missense probably damaging 1.00
IGL02263:Dsg2 APN 18 20,723,077 (GRCm39) missense possibly damaging 0.70
IGL02410:Dsg2 APN 18 20,735,189 (GRCm39) missense probably benign 0.04
IGL02553:Dsg2 APN 18 20,725,467 (GRCm39) missense probably damaging 1.00
IGL03036:Dsg2 APN 18 20,712,134 (GRCm39) missense probably damaging 0.99
dissolute UTSW 18 20,729,008 (GRCm39) splice site probably null
Dysjunction UTSW 18 20,715,996 (GRCm39) nonsense probably null
weg UTSW 18 20,713,708 (GRCm39) nonsense probably null
R0094:Dsg2 UTSW 18 20,724,910 (GRCm39) missense probably benign 0.08
R0094:Dsg2 UTSW 18 20,724,910 (GRCm39) missense probably benign 0.08
R0105:Dsg2 UTSW 18 20,735,111 (GRCm39) missense probably benign 0.03
R0105:Dsg2 UTSW 18 20,735,111 (GRCm39) missense probably benign 0.03
R0112:Dsg2 UTSW 18 20,716,099 (GRCm39) missense probably benign 0.02
R0305:Dsg2 UTSW 18 20,715,752 (GRCm39) splice site probably benign
R0380:Dsg2 UTSW 18 20,715,996 (GRCm39) nonsense probably null
R0401:Dsg2 UTSW 18 20,725,565 (GRCm39) splice site probably benign
R0421:Dsg2 UTSW 18 20,712,448 (GRCm39) missense probably damaging 1.00
R0578:Dsg2 UTSW 18 20,727,291 (GRCm39) missense probably benign 0.00
R0667:Dsg2 UTSW 18 20,706,556 (GRCm39) missense possibly damaging 0.50
R1223:Dsg2 UTSW 18 20,706,550 (GRCm39) missense probably benign 0.23
R1433:Dsg2 UTSW 18 20,715,780 (GRCm39) missense probably damaging 0.98
R1543:Dsg2 UTSW 18 20,727,268 (GRCm39) missense probably benign 0.33
R1730:Dsg2 UTSW 18 20,724,937 (GRCm39) missense probably benign 0.01
R1783:Dsg2 UTSW 18 20,724,937 (GRCm39) missense probably benign 0.01
R1946:Dsg2 UTSW 18 20,713,605 (GRCm39) missense probably damaging 1.00
R1991:Dsg2 UTSW 18 20,734,530 (GRCm39) missense probably damaging 1.00
R1992:Dsg2 UTSW 18 20,734,530 (GRCm39) missense probably damaging 1.00
R2027:Dsg2 UTSW 18 20,716,061 (GRCm39) unclassified probably benign
R2109:Dsg2 UTSW 18 20,725,346 (GRCm39) missense probably benign 0.00
R2143:Dsg2 UTSW 18 20,712,218 (GRCm39) missense probably damaging 1.00
R2201:Dsg2 UTSW 18 20,729,111 (GRCm39) missense probably damaging 1.00
R2343:Dsg2 UTSW 18 20,735,355 (GRCm39) missense probably damaging 0.99
R2937:Dsg2 UTSW 18 20,712,185 (GRCm39) missense probably damaging 1.00
R3710:Dsg2 UTSW 18 20,735,174 (GRCm39) missense probably damaging 1.00
R3734:Dsg2 UTSW 18 20,735,004 (GRCm39) missense probably benign 0.41
R3773:Dsg2 UTSW 18 20,724,919 (GRCm39) missense probably damaging 1.00
R4176:Dsg2 UTSW 18 20,713,720 (GRCm39) missense probably benign 0.25
R4299:Dsg2 UTSW 18 20,729,008 (GRCm39) splice site probably null
R4515:Dsg2 UTSW 18 20,734,444 (GRCm39) missense probably benign
R4649:Dsg2 UTSW 18 20,735,302 (GRCm39) missense possibly damaging 0.56
R4940:Dsg2 UTSW 18 20,712,487 (GRCm39) missense probably damaging 1.00
R4949:Dsg2 UTSW 18 20,723,241 (GRCm39) missense probably damaging 1.00
R4998:Dsg2 UTSW 18 20,734,578 (GRCm39) missense probably benign 0.26
R5078:Dsg2 UTSW 18 20,729,140 (GRCm39) critical splice donor site probably null
R5155:Dsg2 UTSW 18 20,731,715 (GRCm39) missense possibly damaging 0.67
R5398:Dsg2 UTSW 18 20,712,190 (GRCm39) missense probably benign 0.45
R5503:Dsg2 UTSW 18 20,713,708 (GRCm39) nonsense probably null
R6133:Dsg2 UTSW 18 20,723,146 (GRCm39) missense probably benign 0.00
R6163:Dsg2 UTSW 18 20,731,726 (GRCm39) critical splice donor site probably null
R6226:Dsg2 UTSW 18 20,712,506 (GRCm39) missense probably damaging 0.98
R6228:Dsg2 UTSW 18 20,727,350 (GRCm39) critical splice donor site probably null
R6241:Dsg2 UTSW 18 20,723,274 (GRCm39) splice site probably null
R6482:Dsg2 UTSW 18 20,734,371 (GRCm39) missense possibly damaging 0.69
R6524:Dsg2 UTSW 18 20,716,093 (GRCm39) missense probably damaging 1.00
R6856:Dsg2 UTSW 18 20,734,859 (GRCm39) missense probably damaging 0.98
R7058:Dsg2 UTSW 18 20,725,332 (GRCm39) missense probably benign 0.00
R7108:Dsg2 UTSW 18 20,734,920 (GRCm39) missense probably damaging 1.00
R7149:Dsg2 UTSW 18 20,712,511 (GRCm39) missense probably damaging 0.98
R7207:Dsg2 UTSW 18 20,734,516 (GRCm39) missense probably damaging 0.99
R7256:Dsg2 UTSW 18 20,724,988 (GRCm39) missense possibly damaging 0.96
R7315:Dsg2 UTSW 18 20,712,217 (GRCm39) missense probably damaging 0.97
R7471:Dsg2 UTSW 18 20,713,675 (GRCm39) missense probably benign 0.08
R7558:Dsg2 UTSW 18 20,727,291 (GRCm39) missense probably benign 0.00
R8094:Dsg2 UTSW 18 20,716,061 (GRCm39) unclassified probably benign
R8118:Dsg2 UTSW 18 20,715,858 (GRCm39) missense probably benign 0.11
R8157:Dsg2 UTSW 18 20,713,606 (GRCm39) missense probably damaging 1.00
R8307:Dsg2 UTSW 18 20,708,121 (GRCm39) missense probably benign 0.19
R8308:Dsg2 UTSW 18 20,708,121 (GRCm39) missense probably benign 0.19
R8488:Dsg2 UTSW 18 20,734,431 (GRCm39) missense probably damaging 1.00
R8520:Dsg2 UTSW 18 20,712,508 (GRCm39) missense probably damaging 1.00
R8669:Dsg2 UTSW 18 20,723,132 (GRCm39) missense probably damaging 1.00
R8675:Dsg2 UTSW 18 20,734,975 (GRCm39) missense possibly damaging 0.75
R8750:Dsg2 UTSW 18 20,708,069 (GRCm39) missense possibly damaging 0.90
R8773:Dsg2 UTSW 18 20,716,056 (GRCm39) missense probably damaging 1.00
R8888:Dsg2 UTSW 18 20,723,126 (GRCm39) missense probably damaging 1.00
R8895:Dsg2 UTSW 18 20,723,126 (GRCm39) missense probably damaging 1.00
R8912:Dsg2 UTSW 18 20,715,878 (GRCm39) missense probably damaging 1.00
R8925:Dsg2 UTSW 18 20,725,535 (GRCm39) missense probably damaging 1.00
R8927:Dsg2 UTSW 18 20,725,535 (GRCm39) missense probably damaging 1.00
R9263:Dsg2 UTSW 18 20,727,223 (GRCm39) missense probably benign 0.33
R9328:Dsg2 UTSW 18 20,715,847 (GRCm39) missense possibly damaging 0.81
Z1176:Dsg2 UTSW 18 20,713,678 (GRCm39) missense probably damaging 1.00
Z1177:Dsg2 UTSW 18 20,735,306 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTTCCTGCCAAGTACACAC -3'
(R):5'- AACTGGTGCTTACCTCTGTG -3'

Sequencing Primer
(F):5'- GTGAGCTGTGTTCACCCCTAG -3'
(R):5'- ACTGGTGCTTACCTCTGTGAAGTAAC -3'
Posted On 2015-06-10