Incidental Mutation 'R4213:Dsg2'
ID 319317
Institutional Source Beutler Lab
Gene Symbol Dsg2
Ensembl Gene ENSMUSG00000044393
Gene Name desmoglein 2
Synonyms D18Ertd293e
MMRRC Submission 041040-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock # R4213 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 20558074-20604521 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 20598514 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 731 (L731P)
Ref Sequence ENSEMBL: ENSMUSP00000057096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059787]
AlphaFold O55111
Predicted Effect probably benign
Transcript: ENSMUST00000059787
AA Change: L731P

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000057096
Gene: ENSMUSG00000044393
AA Change: L731P

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 75 162 2.39e-8 SMART
CA 186 275 5.17e-27 SMART
CA 298 392 1.94e-8 SMART
CA 418 502 2.34e-16 SMART
transmembrane domain 618 640 N/A INTRINSIC
low complexity region 822 838 N/A INTRINSIC
low complexity region 914 928 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130296
Meta Mutation Damage Score 0.1318 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Mice lacking the encoded protein die in utero. Mutant mice lacking a part of the extracellular adhesive domain of the encoded protein develop cardiac fibrosis and dilation. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality before somite formation, impaired cell proliferation, and increased apoptosis. Heterozygous mutation of this gene also results in embryonic lethality before somite formation with partial penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik G A 3: 92,869,127 P83L probably benign Het
Ankrd11 A C 8: 122,891,026 V2029G probably benign Het
Arhgap28 A T 17: 67,871,993 V291E probably benign Het
Cad G A 5: 31,072,344 V1390I probably benign Het
Cadps2 A T 6: 23,599,463 D281E probably damaging Het
Celsr1 G A 15: 86,031,807 T655I probably damaging Het
Cep350 C G 1: 155,935,961 G411A probably damaging Het
Chml A T 1: 175,686,695 F210L probably damaging Het
Col4a4 A T 1: 82,453,144 M1679K unknown Het
Depdc1b T G 13: 108,388,691 F527V probably damaging Het
Fam69b C T 2: 26,635,948 T298I probably benign Het
Fbxo25 A G 8: 13,939,581 T343A probably damaging Het
Gk5 T C 9: 96,129,053 L72P probably damaging Het
Gm15448 C A 7: 3,821,554 A510S probably damaging Het
Gm648 C T X: 56,545,208 V78I probably benign Het
Gpr137c G A 14: 45,246,508 E231K probably damaging Het
Hdc C T 2: 126,597,866 probably null Het
Hydin A G 8: 110,456,507 N1112S possibly damaging Het
Itgae A G 11: 73,119,352 H556R probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 74 probably benign Het
Krtap17-1 A G 11: 99,993,914 L9P unknown Het
Nmur1 T G 1: 86,387,784 T87P probably damaging Het
Olfr1155 T C 2: 87,943,121 Y169C probably benign Het
Ppp2r5e A G 12: 75,469,551 I244T probably damaging Het
Robo3 C T 9: 37,421,898 G781D probably damaging Het
Siglec1 C T 2: 131,074,118 E1275K probably damaging Het
Slc2a12 A T 10: 22,702,094 K596N probably benign Het
Sorcs1 G A 19: 50,225,175 R705C probably damaging Het
Sqor G T 2: 122,787,498 G92V probably damaging Het
Tlr4 T A 4: 66,840,326 I452N probably damaging Het
Tob1 A G 11: 94,214,192 T185A probably damaging Het
Yjefn3 G T 8: 69,890,890 H50Q probably benign Het
Zswim1 T C 2: 164,825,785 V319A probably benign Het
Other mutations in Dsg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Dsg2 APN 18 20601769 missense probably benign 0.10
IGL00979:Dsg2 APN 18 20582767 missense probably damaging 0.99
IGL01081:Dsg2 APN 18 20589942 unclassified probably benign
IGL01358:Dsg2 APN 18 20601793 missense probably damaging 0.98
IGL02002:Dsg2 APN 18 20579176 missense probably damaging 1.00
IGL02263:Dsg2 APN 18 20590020 missense possibly damaging 0.70
IGL02410:Dsg2 APN 18 20602132 missense probably benign 0.04
IGL02553:Dsg2 APN 18 20592410 missense probably damaging 1.00
IGL03036:Dsg2 APN 18 20579077 missense probably damaging 0.99
dissolute UTSW 18 20595951 splice site probably null
Dysjunction UTSW 18 20582939 nonsense probably null
weg UTSW 18 20580651 nonsense probably null
R0094:Dsg2 UTSW 18 20591853 missense probably benign 0.08
R0094:Dsg2 UTSW 18 20591853 missense probably benign 0.08
R0105:Dsg2 UTSW 18 20602054 missense probably benign 0.03
R0105:Dsg2 UTSW 18 20602054 missense probably benign 0.03
R0112:Dsg2 UTSW 18 20583042 missense probably benign 0.02
R0305:Dsg2 UTSW 18 20582695 splice site probably benign
R0380:Dsg2 UTSW 18 20582939 nonsense probably null
R0401:Dsg2 UTSW 18 20592508 splice site probably benign
R0421:Dsg2 UTSW 18 20579391 missense probably damaging 1.00
R0578:Dsg2 UTSW 18 20594234 missense probably benign 0.00
R0667:Dsg2 UTSW 18 20573499 missense possibly damaging 0.50
R1223:Dsg2 UTSW 18 20573493 missense probably benign 0.23
R1433:Dsg2 UTSW 18 20582723 missense probably damaging 0.98
R1543:Dsg2 UTSW 18 20594211 missense probably benign 0.33
R1730:Dsg2 UTSW 18 20591880 missense probably benign 0.01
R1783:Dsg2 UTSW 18 20591880 missense probably benign 0.01
R1946:Dsg2 UTSW 18 20580548 missense probably damaging 1.00
R1991:Dsg2 UTSW 18 20601473 missense probably damaging 1.00
R1992:Dsg2 UTSW 18 20601473 missense probably damaging 1.00
R2027:Dsg2 UTSW 18 20583004 unclassified probably benign
R2109:Dsg2 UTSW 18 20592289 missense probably benign 0.00
R2143:Dsg2 UTSW 18 20579161 missense probably damaging 1.00
R2201:Dsg2 UTSW 18 20596054 missense probably damaging 1.00
R2343:Dsg2 UTSW 18 20602298 missense probably damaging 0.99
R2937:Dsg2 UTSW 18 20579128 missense probably damaging 1.00
R3710:Dsg2 UTSW 18 20602117 missense probably damaging 1.00
R3734:Dsg2 UTSW 18 20601947 missense probably benign 0.41
R3773:Dsg2 UTSW 18 20591862 missense probably damaging 1.00
R4176:Dsg2 UTSW 18 20580663 missense probably benign 0.25
R4299:Dsg2 UTSW 18 20595951 splice site probably null
R4515:Dsg2 UTSW 18 20601387 missense probably benign
R4649:Dsg2 UTSW 18 20602245 missense possibly damaging 0.56
R4940:Dsg2 UTSW 18 20579430 missense probably damaging 1.00
R4949:Dsg2 UTSW 18 20590184 missense probably damaging 1.00
R4998:Dsg2 UTSW 18 20601521 missense probably benign 0.26
R5078:Dsg2 UTSW 18 20596083 critical splice donor site probably null
R5155:Dsg2 UTSW 18 20598658 missense possibly damaging 0.67
R5398:Dsg2 UTSW 18 20579133 missense probably benign 0.45
R5503:Dsg2 UTSW 18 20580651 nonsense probably null
R6133:Dsg2 UTSW 18 20590089 missense probably benign 0.00
R6163:Dsg2 UTSW 18 20598669 critical splice donor site probably null
R6226:Dsg2 UTSW 18 20579449 missense probably damaging 0.98
R6228:Dsg2 UTSW 18 20594293 critical splice donor site probably null
R6241:Dsg2 UTSW 18 20590217 splice site probably null
R6482:Dsg2 UTSW 18 20601314 missense possibly damaging 0.69
R6524:Dsg2 UTSW 18 20583036 missense probably damaging 1.00
R6856:Dsg2 UTSW 18 20601802 missense probably damaging 0.98
R7058:Dsg2 UTSW 18 20592275 missense probably benign 0.00
R7108:Dsg2 UTSW 18 20601863 missense probably damaging 1.00
R7149:Dsg2 UTSW 18 20579454 missense probably damaging 0.98
R7207:Dsg2 UTSW 18 20601459 missense probably damaging 0.99
R7256:Dsg2 UTSW 18 20591931 missense possibly damaging 0.96
R7315:Dsg2 UTSW 18 20579160 missense probably damaging 0.97
R7471:Dsg2 UTSW 18 20580618 missense probably benign 0.08
R7558:Dsg2 UTSW 18 20594234 missense probably benign 0.00
R8094:Dsg2 UTSW 18 20583004 unclassified probably benign
R8118:Dsg2 UTSW 18 20582801 missense probably benign 0.11
R8157:Dsg2 UTSW 18 20580549 missense probably damaging 1.00
R8307:Dsg2 UTSW 18 20575064 missense probably benign 0.19
R8308:Dsg2 UTSW 18 20575064 missense probably benign 0.19
R8488:Dsg2 UTSW 18 20601374 missense probably damaging 1.00
R8520:Dsg2 UTSW 18 20579451 missense probably damaging 1.00
R8669:Dsg2 UTSW 18 20590075 missense probably damaging 1.00
R8675:Dsg2 UTSW 18 20601918 missense possibly damaging 0.75
R8750:Dsg2 UTSW 18 20575012 missense possibly damaging 0.90
R8773:Dsg2 UTSW 18 20582999 missense probably damaging 1.00
R8888:Dsg2 UTSW 18 20590069 missense probably damaging 1.00
R8895:Dsg2 UTSW 18 20590069 missense probably damaging 1.00
R8912:Dsg2 UTSW 18 20582821 missense probably damaging 1.00
R8925:Dsg2 UTSW 18 20592478 missense probably damaging 1.00
R8927:Dsg2 UTSW 18 20592478 missense probably damaging 1.00
R9263:Dsg2 UTSW 18 20594166 missense probably benign 0.33
R9328:Dsg2 UTSW 18 20582790 missense possibly damaging 0.81
Z1176:Dsg2 UTSW 18 20580621 missense probably damaging 1.00
Z1177:Dsg2 UTSW 18 20602249 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTTCCTGCCAAGTACACAC -3'
(R):5'- AACTGGTGCTTACCTCTGTG -3'

Sequencing Primer
(F):5'- GTGAGCTGTGTTCACCCCTAG -3'
(R):5'- ACTGGTGCTTACCTCTGTGAAGTAAC -3'
Posted On 2015-06-10