Mutagenetix > Incidental Mutation

Incidental Mutation 'R4213:Sorcs1'

319318

Institutional Source

Beutler Lab

Gene Symbol

Sorcs1

Ensembl Gene

ENSMUSG00000043531

Gene Name

sortilin-related VPS10 domain containing receptor 1

Synonyms

MMRRC Submission

041040-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.080) question?

Stock #

R4213 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

50143299-50678646 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 50225175 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 705 (R705C)

Ref Sequence

ENSEMBL: ENSMUSP00000147591 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072685] [ENSMUST00000111756] [ENSMUST00000164039] [ENSMUST00000209413] [ENSMUST00000209783] [ENSMUST00000211008] [ENSMUST00000211687]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000072685
AA Change: R705C

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000072472
Gene: ENSMUSG00000043531
AA Change: R705C

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	94	113	N/A	INTRINSIC
VPS10	196	797	N/A	SMART
PKD	799	889	3.84e-1	SMART
PKD	897	975	8.63e-1	SMART
transmembrane domain	1098	1120	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000111756
AA Change: R705C

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000107386
Gene: ENSMUSG00000043531
AA Change: R705C

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	94	113	N/A	INTRINSIC
VPS10	196	797	N/A	SMART
PKD	799	889	3.84e-1	SMART
PKD	897	975	8.63e-1	SMART
transmembrane domain	1098	1120	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000164039
AA Change: R705C

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000132615
Gene: ENSMUSG00000043531
AA Change: R705C

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	94	113	N/A	INTRINSIC
VPS10	196	797	N/A	SMART
PKD	799	889	3.84e-1	SMART
PKD	897	975	8.63e-1	SMART
transmembrane domain	1098	1120	N/A	INTRINSIC
low complexity region	1129	1142	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000168357

SMART Domains

Protein: ENSMUSP00000129190
Gene: ENSMUSG00000043531

Domain	Start	End	E-Value	Type
VPS10	1	320	6.99e-58	SMART
PKD	322	412	3.84e-1	SMART
PKD	420	498	8.63e-1	SMART
transmembrane domain	621	643	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000209413
AA Change: R705C

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000209783
AA Change: R705C

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)

Predicted Effect

probably damaging
Transcript: ENSMUST00000211008
AA Change: R705C

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

Predicted Effect

probably damaging
Transcript: ENSMUST00000211687
AA Change: R705C

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.6%

Validation Efficiency

97% (38/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. Two of the five family members (sortilin and sortilin-related receptor) are synthesized as preproproteins; it is not yet known if this encoded protein is also a preproprotein. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Female mice homozygous for a null allele have abnormal amyloid beta levels in the brain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310050C09Rik	G	A	3: 92,869,127	P83L	probably benign	Het
Ankrd11	A	C	8: 122,891,026	V2029G	probably benign	Het
Arhgap28	A	T	17: 67,871,993	V291E	probably benign	Het
Cad	G	A	5: 31,072,344	V1390I	probably benign	Het
Cadps2	A	T	6: 23,599,463	D281E	probably damaging	Het
Celsr1	G	A	15: 86,031,807	T655I	probably damaging	Het
Cep350	C	G	1: 155,935,961	G411A	probably damaging	Het
Chml	A	T	1: 175,686,695	F210L	probably damaging	Het
Col4a4	A	T	1: 82,453,144	M1679K	unknown	Het
Depdc1b	T	G	13: 108,388,691	F527V	probably damaging	Het
Dsg2	T	C	18: 20,598,514	L731P	probably benign	Het
Fam69b	C	T	2: 26,635,948	T298I	probably benign	Het
Fbxo25	A	G	8: 13,939,581	T343A	probably damaging	Het
Gk5	T	C	9: 96,129,053	L72P	probably damaging	Het
Gm15448	C	A	7: 3,821,554	A510S	probably damaging	Het
Gm648	C	T	X: 56,545,208	V78I	probably benign	Het
Gpr137c	G	A	14: 45,246,508	E231K	probably damaging	Het
Hdc	C	T	2: 126,597,866		probably null	Het
Hydin	A	G	8: 110,456,507	N1112S	possibly damaging	Het
Itgae	A	G	11: 73,119,352	H556R	probably benign	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 52,725,906	74	probably benign	Het
Krtap17-1	A	G	11: 99,993,914	L9P	unknown	Het
Nmur1	T	G	1: 86,387,784	T87P	probably damaging	Het
Olfr1155	T	C	2: 87,943,121	Y169C	probably benign	Het
Ppp2r5e	A	G	12: 75,469,551	I244T	probably damaging	Het
Robo3	C	T	9: 37,421,898	G781D	probably damaging	Het
Siglec1	C	T	2: 131,074,118	E1275K	probably damaging	Het
Slc2a12	A	T	10: 22,702,094	K596N	probably benign	Het
Sqor	G	T	2: 122,787,498	G92V	probably damaging	Het
Tlr4	T	A	4: 66,840,326	I452N	probably damaging	Het
Tob1	A	G	11: 94,214,192	T185A	probably damaging	Het
Yjefn3	G	T	8: 69,890,890	H50Q	probably benign	Het
Zswim1	T	C	2: 164,825,785	V319A	probably benign	Het

Other mutations in Sorcs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Sorcs1	APN	19	50190054	missense	probably damaging	1.00
IGL00983:Sorcs1	APN	19	50176128	missense	probably damaging	0.98
IGL01125:Sorcs1	APN	19	50228201	missense	probably damaging	1.00
IGL01320:Sorcs1	APN	19	50288079	splice site	probably benign
IGL01445:Sorcs1	APN	19	50153066	missense	probably damaging	1.00
IGL01682:Sorcs1	APN	19	50181506	missense	probably benign	0.43
IGL01799:Sorcs1	APN	19	50230209	critical splice donor site	probably null
IGL02044:Sorcs1	APN	19	50288159	splice site	probably benign
IGL02111:Sorcs1	APN	19	50230245	missense	probably benign	0.00
IGL02364:Sorcs1	APN	19	50333598	missense	probably damaging	1.00
IGL02378:Sorcs1	APN	19	50182671	nonsense	probably null
IGL02498:Sorcs1	APN	19	50678168	missense	probably benign
IGL02658:Sorcs1	APN	19	50190092	missense	probably damaging	1.00
IGL02939:Sorcs1	APN	19	50677930	nonsense	probably null
IGL02942:Sorcs1	APN	19	50475437	missense	probably damaging	1.00
IGL03057:Sorcs1	APN	19	50259756	nonsense	probably null
IGL03230:Sorcs1	APN	19	50242093	missense	probably damaging	1.00
P0033:Sorcs1	UTSW	19	50152907	missense	probably damaging	0.98
R0109:Sorcs1	UTSW	19	50378891	splice site	probably benign
R0115:Sorcs1	UTSW	19	50636453	intron	probably benign
R0242:Sorcs1	UTSW	19	50228221	missense	probably damaging	1.00
R0242:Sorcs1	UTSW	19	50228221	missense	probably damaging	1.00
R0325:Sorcs1	UTSW	19	50313042	splice site	probably null
R0481:Sorcs1	UTSW	19	50636453	intron	probably benign
R0581:Sorcs1	UTSW	19	50252701	missense	possibly damaging	0.70
R0669:Sorcs1	UTSW	19	50241942	splice site	probably benign
R0980:Sorcs1	UTSW	19	50232323	missense	probably benign	0.04
R1158:Sorcs1	UTSW	19	50144160	unclassified	probably benign
R1519:Sorcs1	UTSW	19	50252587	missense	probably benign	0.05
R1669:Sorcs1	UTSW	19	50475422	missense	probably damaging	0.99
R1779:Sorcs1	UTSW	19	50175043	splice site	probably benign
R1783:Sorcs1	UTSW	19	50228309	critical splice acceptor site	probably null
R1927:Sorcs1	UTSW	19	50222195	missense	probably damaging	1.00
R1935:Sorcs1	UTSW	19	50232644	missense	probably damaging	0.96
R1936:Sorcs1	UTSW	19	50232644	missense	probably damaging	0.96
R2109:Sorcs1	UTSW	19	50678192	missense	probably benign
R2206:Sorcs1	UTSW	19	50230217	missense	possibly damaging	0.81
R2207:Sorcs1	UTSW	19	50230217	missense	possibly damaging	0.81
R3031:Sorcs1	UTSW	19	50225175	missense	probably damaging	0.98
R3032:Sorcs1	UTSW	19	50225175	missense	probably damaging	0.98
R3107:Sorcs1	UTSW	19	50210650	missense	possibly damaging	0.83
R3508:Sorcs1	UTSW	19	50225175	missense	probably damaging	0.98
R3738:Sorcs1	UTSW	19	50151221	missense	probably benign	0.03
R4127:Sorcs1	UTSW	19	50222159	missense	probably benign	0.29
R4212:Sorcs1	UTSW	19	50225175	missense	probably damaging	0.98
R4385:Sorcs1	UTSW	19	50190161	missense	probably benign	0.01
R4424:Sorcs1	UTSW	19	50378941	missense	probably damaging	0.97
R4603:Sorcs1	UTSW	19	50312964	critical splice donor site	probably null
R4679:Sorcs1	UTSW	19	50182669	missense	probably benign
R4780:Sorcs1	UTSW	19	50143981	unclassified	probably benign
R4781:Sorcs1	UTSW	19	50182681	missense	probably damaging	1.00
R4823:Sorcs1	UTSW	19	50678140	missense	possibly damaging	0.92
R4823:Sorcs1	UTSW	19	50230302	missense	possibly damaging	0.87
R4883:Sorcs1	UTSW	19	50232303	missense	probably benign	0.00
R5091:Sorcs1	UTSW	19	50259752	critical splice donor site	probably null
R5105:Sorcs1	UTSW	19	50225141	missense	possibly damaging	0.57
R5437:Sorcs1	UTSW	19	50252602	missense	probably benign	0.19
R5574:Sorcs1	UTSW	19	50222133	missense	probably damaging	1.00
R5734:Sorcs1	UTSW	19	50182775	missense	probably benign	0.04
R6045:Sorcs1	UTSW	19	50190117	nonsense	probably null
R6091:Sorcs1	UTSW	19	50288101	missense	possibly damaging	0.64
R6119:Sorcs1	UTSW	19	50288094	missense	probably damaging	0.98
R6226:Sorcs1	UTSW	19	50181414	missense	probably damaging	1.00
R6337:Sorcs1	UTSW	19	50144124	missense	probably benign	0.00
R6378:Sorcs1	UTSW	19	50225177	missense	possibly damaging	0.57
R6782:Sorcs1	UTSW	19	50176122	nonsense	probably null
R6792:Sorcs1	UTSW	19	50678168	missense	probably benign
R6891:Sorcs1	UTSW	19	50225119	nonsense	probably null
R7151:Sorcs1	UTSW	19	50312982	missense	probably damaging	1.00
R7223:Sorcs1	UTSW	19	50190042	missense	probably benign	0.06
R7356:Sorcs1	UTSW	19	50175157	missense	possibly damaging	0.86
R7471:Sorcs1	UTSW	19	50262263	missense	probably damaging	1.00
R7474:Sorcs1	UTSW	19	50153112	missense	possibly damaging	0.65
R7503:Sorcs1	UTSW	19	50153052	missense	probably benign
R7506:Sorcs1	UTSW	19	50182674	nonsense	probably null
R7573:Sorcs1	UTSW	19	50152796	nonsense	probably null
R7867:Sorcs1	UTSW	19	50230260	nonsense	probably null
R7911:Sorcs1	UTSW	19	50144032	missense	unknown
R8032:Sorcs1	UTSW	19	50475408	missense	probably benign	0.28
R8063:Sorcs1	UTSW	19	50143977	missense	unknown
R8463:Sorcs1	UTSW	19	50259810	missense	probably damaging	1.00
R8682:Sorcs1	UTSW	19	50378960	missense	probably damaging	0.99
R8724:Sorcs1	UTSW	19	50151220	missense	probably benign	0.33
R8926:Sorcs1	UTSW	19	50252658	missense	possibly damaging	0.94
R9160:Sorcs1	UTSW	19	50225220	missense	probably damaging	1.00
R9173:Sorcs1	UTSW	19	50232315	missense	possibly damaging	0.92
R9203:Sorcs1	UTSW	19	50262295	missense	probably damaging	1.00
R9229:Sorcs1	UTSW	19	50152862	missense	probably benign	0.17
R9398:Sorcs1	UTSW	19	50225213	missense	possibly damaging	0.90
R9430:Sorcs1	UTSW	19	50210770	missense	probably damaging	1.00
R9510:Sorcs1	UTSW	19	50678083	missense	probably benign	0.04
R9511:Sorcs1	UTSW	19	50678083	missense	probably benign	0.04
R9744:Sorcs1	UTSW	19	50226837	missense	probably damaging	1.00
R9777:Sorcs1	UTSW	19	50259752	critical splice donor site	probably null
X0024:Sorcs1	UTSW	19	50182763	missense	possibly damaging	0.92
Z1088:Sorcs1	UTSW	19	50222143	missense	probably benign	0.16
Z1177:Sorcs1	UTSW	19	50226742	missense	probably null	1.00
Z1177:Sorcs1	UTSW	19	50333599	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TATAAGGTCTGCCACTTAGCGC -3'
(R):5'- CGTCAAAACGGAAATACTAATAGCG -3'

Sequencing Primer
(F):5'- GCCACTTAGCGCTAGTTTTG -3'
(R):5'- ACTAATAGCGTGAATTGGGTTCCC -3'

Posted On

2015-06-10