Mutagenetix > Incidental Mutation

Incidental Mutation 'R4214:Aox2'

319325

Institutional Source

Beutler Lab

Gene Symbol

Aox2

Ensembl Gene

ENSMUSG00000079554

Gene Name

aldehyde oxidase 2

Synonyms

Aox3l1

MMRRC Submission

041041-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.068) question?

Stock #

R4214 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

58278326-58380259 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 58307444 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000110006 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114366]

AlphaFold

Q5SGK3

Predicted Effect

probably null
Transcript: ENSMUST00000114366

SMART Domains

Protein: ENSMUSP00000110006
Gene: ENSMUSG00000079554

Domain	Start	End	E-Value	Type
Pfam:Fer2	13	83	3.4e-9	PFAM
Pfam:Fer2_2	92	166	4.2e-30	PFAM
Pfam:FAD_binding_5	241	421	5.1e-46	PFAM
CO_deh_flav_C	428	532	1.4e-23	SMART
Ald_Xan_dh_C	604	707	4.64e-47	SMART
Pfam:Ald_Xan_dh_C2	717	1251	1.3e-178	PFAM
low complexity region	1257	1271	N/A	INTRINSIC
low complexity region	1285	1303	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161126

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.2%
20x: 95.5%

Validation Efficiency

98% (64/65)

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A730013G03Rik	C	T	1: 192,833,537		noncoding transcript	Het
Abca12	T	A	1: 71,288,697	D1408V	probably damaging	Het
Abca13	A	T	11: 9,293,877	L1913F	probably damaging	Het
Acad9	A	G	3: 36,073,603	E118G	probably damaging	Het
Adamts5	G	A	16: 85,868,643	A590V	probably damaging	Het
Ano6	A	C	15: 95,965,909	Y791S	probably benign	Het
Aox4	T	A	1: 58,221,892	I128N	probably damaging	Het
Atp2b3	A	G	X: 73,570,315	M1142V	probably benign	Het
AU041133	A	G	10: 82,151,389	H292R	probably damaging	Het
Bco2	A	G	9: 50,545,366	M158T	probably benign	Het
Bpnt1	T	A	1: 185,345,429		probably benign	Het
Cadm1	A	G	9: 47,797,443	D157G	probably damaging	Het
Catsperg1	T	C	7: 29,195,932	R499G	possibly damaging	Het
Ccr7	T	C	11: 99,145,046	E350G	probably damaging	Het
Ceacam5	T	A	7: 17,752,151	S524R	probably benign	Het
Cep78	T	C	19: 15,959,579	T588A	probably benign	Het
Cfap65	T	A	1: 74,927,681	E282D	possibly damaging	Het
Drd2	A	G	9: 49,404,921	K327R	probably benign	Het
Erich5	C	T	15: 34,471,411	P262L	possibly damaging	Het
Ezh2	A	C	6: 47,533,814	D578E	probably damaging	Het
Fez1	A	G	9: 36,870,488	N20S	probably damaging	Het
Folr2	T	G	7: 101,843,699	K39T	probably damaging	Het
Gm10549	G	T	18: 33,464,477		probably null	Het
Gm14393	C	T	2: 175,061,847	C89Y	probably benign	Het
Gm5329	T	G	7: 31,972,403		noncoding transcript	Het
Gm7367	A	G	7: 60,155,769		noncoding transcript	Het
Gpr162	A	T	6: 124,860,068	W338R	probably damaging	Het
Ift80	A	T	3: 68,990,808	F65I	possibly damaging	Het
Klra6	T	G	6: 130,018,922	I158L	probably benign	Het
Lpp	T	A	16: 24,762,054	Y173*	probably null	Het
Lrp12	A	G	15: 39,872,580	V671A	probably benign	Het
Lrrc27	C	T	7: 139,223,693	R178C	probably damaging	Het
Lrrc49	G	A	9: 60,666,326	T225M	probably benign	Het
Megf8	T	A	7: 25,355,368	S1915T	probably benign	Het
Mmadhc	T	C	2: 50,291,332	T109A	probably benign	Het
Mon2	T	C	10: 123,016,492	E992G	probably benign	Het
Msl3	A	T	X: 168,662,434	N430K	probably damaging	Het
Msl3	A	G	X: 168,667,063	I267T	probably damaging	Het
Nab2	G	T	10: 127,665,048	Y25*	probably null	Het
Notch3	T	C	17: 32,132,207	E1938G	possibly damaging	Het
Olfr291	C	T	7: 84,857,289	H307Y	probably benign	Het
Osgepl1	A	G	1: 53,315,008	T44A	probably damaging	Het
Pdpr	A	G	8: 111,129,580		probably benign	Het
Pfkp	A	G	13: 6,619,225	S241P	probably damaging	Het
Phgdh	A	T	3: 98,328,061	S166T	possibly damaging	Het
Plcl1	C	T	1: 55,751,335	Q1055*	probably null	Het
Plscr2	A	G	9: 92,287,737	N80S	probably benign	Het
Polr3k	A	T	2: 181,868,242	M80L	probably benign	Het
Prex2	A	G	1: 11,101,159	D304G	probably damaging	Het
Prex2	A	G	1: 11,285,061	T1529A	probably damaging	Het
Rcvrn	A	T	11: 67,695,688	H91L	possibly damaging	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
Tbx18	T	C	9: 87,724,465	Y209C	probably damaging	Het
Themis3	T	C	17: 66,560,017	N76S	probably benign	Het
Trhde	A	T	10: 114,788,070	S310T	possibly damaging	Het
Vmn1r213	G	A	13: 23,012,003	C252Y	possibly damaging	Het
Zfp523	T	C	17: 28,201,029	V216A	probably benign	Het

Other mutations in Aox2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01014:Aox2	APN	1	58322801	missense	possibly damaging	0.73
IGL01288:Aox2	APN	1	58294407	missense	probably damaging	0.99
IGL01383:Aox2	APN	1	58294305	missense	probably benign	0.09
IGL01734:Aox2	APN	1	58354310	missense	possibly damaging	0.95
IGL01793:Aox2	APN	1	58336624	missense	possibly damaging	0.79
IGL01834:Aox2	APN	1	58309024	missense	possibly damaging	0.90
IGL01924:Aox2	APN	1	58287743	missense	possibly damaging	0.90
IGL02591:Aox2	APN	1	58358999	nonsense	probably null
IGL02645:Aox2	APN	1	58334724	missense	probably damaging	1.00
IGL02710:Aox2	APN	1	58334769	critical splice donor site	probably null
IGL02801:Aox2	APN	1	58354177	missense	probably damaging	1.00
IGL02988:Aox2	APN	1	58337350	missense	probably benign
IGL03104:Aox2	APN	1	58282759	missense	probably benign
IGL03121:Aox2	APN	1	58358954	missense	probably damaging	1.00
IGL03191:Aox2	APN	1	58359069	missense	probably null	0.98
IGL03236:Aox2	APN	1	58309997	nonsense	probably null
IGL03409:Aox2	APN	1	58354429	missense	possibly damaging	0.91
PIT4362001:Aox2	UTSW	1	58282680	missense	probably damaging	1.00
R0035:Aox2	UTSW	1	58354422	missense	probably benign	0.00
R0035:Aox2	UTSW	1	58354422	missense	probably benign	0.00
R0267:Aox2	UTSW	1	58339446	splice site	probably benign
R0388:Aox2	UTSW	1	58354406	missense	probably damaging	1.00
R0409:Aox2	UTSW	1	58336624	missense	possibly damaging	0.90
R0547:Aox2	UTSW	1	58310042	missense	probably damaging	0.96
R0630:Aox2	UTSW	1	58337321	splice site	probably benign
R0726:Aox2	UTSW	1	58334782	splice site	probably benign
R0734:Aox2	UTSW	1	58305341	missense	probably benign	0.22
R0831:Aox2	UTSW	1	58339683	missense	probably benign	0.28
R0961:Aox2	UTSW	1	58310071	missense	probably benign	0.00
R1404:Aox2	UTSW	1	58346212	splice site	probably benign
R1512:Aox2	UTSW	1	58307351	missense	probably benign	0.00
R1573:Aox2	UTSW	1	58309027	missense	probably benign	0.00
R1592:Aox2	UTSW	1	58300694	missense	probably benign	0.00
R1747:Aox2	UTSW	1	58339592	missense	probably benign	0.01
R1768:Aox2	UTSW	1	58354195	missense	probably benign	0.00
R1809:Aox2	UTSW	1	58294325	missense	probably benign
R1823:Aox2	UTSW	1	58312359	missense	probably benign	0.02
R1834:Aox2	UTSW	1	58308991	missense	probably benign	0.08
R1835:Aox2	UTSW	1	58308991	missense	probably benign	0.08
R1836:Aox2	UTSW	1	58308991	missense	probably benign	0.08
R2219:Aox2	UTSW	1	58349130	splice site	probably null
R2220:Aox2	UTSW	1	58349130	splice site	probably null
R2508:Aox2	UTSW	1	58343673	missense	probably benign	0.38
R2942:Aox2	UTSW	1	58337381	missense	probably benign	0.03
R2967:Aox2	UTSW	1	58322834	missense	probably damaging	0.96
R3082:Aox2	UTSW	1	58283600	splice site	probably benign
R3161:Aox2	UTSW	1	58304438	missense	possibly damaging	0.91
R3408:Aox2	UTSW	1	58343668	missense	probably benign	0.32
R3803:Aox2	UTSW	1	58289899	splice site	probably null
R3894:Aox2	UTSW	1	58334678	critical splice acceptor site	probably null
R4249:Aox2	UTSW	1	58299819	missense	probably benign	0.01
R4666:Aox2	UTSW	1	58304597	nonsense	probably null
R4668:Aox2	UTSW	1	58334694	missense	possibly damaging	0.63
R4703:Aox2	UTSW	1	58358957	missense	possibly damaging	0.78
R4758:Aox2	UTSW	1	58332582	missense	probably benign	0.00
R4890:Aox2	UTSW	1	58334703	missense	probably benign	0.11
R4900:Aox2	UTSW	1	58305385	missense	probably benign
R4924:Aox2	UTSW	1	58305344	missense	probably damaging	1.00
R4970:Aox2	UTSW	1	58310095	splice site	probably null
R5112:Aox2	UTSW	1	58310095	splice site	probably null
R5987:Aox2	UTSW	1	58307359	missense	probably benign	0.00
R6239:Aox2	UTSW	1	58305391	critical splice donor site	probably null
R6273:Aox2	UTSW	1	58339672	missense	probably benign	0.00
R6291:Aox2	UTSW	1	58330806	missense	probably damaging	0.98
R6334:Aox2	UTSW	1	58307407	nonsense	probably null
R6764:Aox2	UTSW	1	58350282	missense	probably damaging	0.97
R6766:Aox2	UTSW	1	58349068	missense	possibly damaging	0.95
R6789:Aox2	UTSW	1	58304485	missense	probably benign	0.01
R6804:Aox2	UTSW	1	58304598	missense	probably benign	0.04
R7007:Aox2	UTSW	1	58330892	missense	probably damaging	1.00
R7015:Aox2	UTSW	1	58282758	missense	probably benign	0.00
R7055:Aox2	UTSW	1	58299768	missense	probably benign	0.08
R7089:Aox2	UTSW	1	58336649	missense	probably benign	0.01
R7157:Aox2	UTSW	1	58283492	missense	probably benign	0.00
R7303:Aox2	UTSW	1	58334765	nonsense	probably null
R7426:Aox2	UTSW	1	58289983	nonsense	probably null
R7762:Aox2	UTSW	1	58349104	missense	probably damaging	1.00
R7899:Aox2	UTSW	1	58281237	splice site	probably null
R7942:Aox2	UTSW	1	58337431	missense	probably damaging	1.00
R7975:Aox2	UTSW	1	58309028	missense	probably benign	0.02
R8029:Aox2	UTSW	1	58343668	missense	probably benign	0.32
R8032:Aox2	UTSW	1	58350283	missense	probably benign	0.01
R8147:Aox2	UTSW	1	58300662	missense	probably benign	0.02
R8165:Aox2	UTSW	1	58308929	missense	probably benign	0.08
R8326:Aox2	UTSW	1	58295887	missense	probably benign
R8770:Aox2	UTSW	1	58339604	missense	probably benign	0.10
R8973:Aox2	UTSW	1	58289954	missense	probably benign	0.34
R9015:Aox2	UTSW	1	58343692	missense	probably damaging	1.00
R9097:Aox2	UTSW	1	58287728	missense	possibly damaging	0.82
R9101:Aox2	UTSW	1	58332637	missense	probably benign	0.03
R9108:Aox2	UTSW	1	58282692	missense	probably damaging	1.00
R9180:Aox2	UTSW	1	58339618	nonsense	probably null
R9258:Aox2	UTSW	1	58312356	missense	probably damaging	1.00
R9293:Aox2	UTSW	1	58322794	missense	possibly damaging	0.86
R9519:Aox2	UTSW	1	58334767	missense	probably damaging	0.98
R9581:Aox2	UTSW	1	58330896	critical splice donor site	probably null
Z1177:Aox2	UTSW	1	58354397	missense	possibly damaging	0.69

Predicted Primers

PCR Primer
(F):5'- GTTATAAGAAGTGAAACCCTGGCAG -3'
(R):5'- AGATCAGTCTGGCAGTGCAG -3'

Sequencing Primer
(F):5'- CTCAGCACATTAGGAGCCG -3'
(R):5'- AGTGCAGCCTTGTGCCCTC -3'

Posted On

2015-06-10